In silico testing:

The use of in silico testing in synthetic biology, and indeed science as a whole, is something which is not to be overlooked. While practical experimentation is still required and an important aspect of any project, the correct use of this kind of testing and modelling can allow for better informed experiments and more efficient testing, which can be extremely important when testing may take long time, or, as in this project's case, become expensive if many experiments are run.

As our diagnostic test would be carried out in the field, where the temperature can not be easily controlled, it was important to determine the integrity of the toehold structures at different temperatures. In order to do this the analysis function of NUPACK was used to perform a melt between 0C and 70C on both toeholds. Briefly, the Green_FET1 toehold structure was shown to be correct from 25C, and the Zeus toehold was shown to be correct from 15C. A full discussion of the results from the NUPACK melt can be found on the results page.

As well as being able to analyse the toehold's structures at different temperatures, the formation of toehold-trigger complex formations can be determined using free energies. As can be seen, as temperature increases, the ΔG of complex formation becomes less negative, meaning that toehold-trigger binding becomes less. Again, full discussion of this can be found on the results page.

The main aim of this testing was to determine the most suitable toehold design to test in the lab, which therefore decreases resources and time spent testing toeholds which would not have been/had very little function.

As well as using purely NUPACK to advise practical experimentation, two main models of the toehold/diagnostic system was created using MatLab. These are a simulation of the system, and a numerical model which could be used to determine optimal conditions for the test. Further explanation and discussion of these models can be found here.

Toehold ordering and construction:

Once our toehold (Zeus) had been designed and passed in silico testing, it and the control toehold (Green_FET1) needed to be ordered. In the paper where Green_FET1 had been experimentally validated, the transcription of it was under the control of a T7 promoter, however we wished to express our toehold under the control of a constitutive promoter, namely J23100. As we wished to use Green_FET1 not only as a control, but also as a comparison in functionality to Zeus, we decided to order Green_FET1 under the control of both a T7 and J23100 promoter.

The toeholds were constructed as gBlocks containing overhangs for the standard pSB1C3 plasmid so as to allow construction of the toehold into the plasmid. The gBlocks were ordered from IDT (Integrated DNA Technology), and constructed using HiFi assembly from NEB (New England Biolabs). The constructs were then transformed, grown in liquid cultures, minipreped, and sent for sequencing. The DNA concentration was also determined by Qubit for use in later toehold testing.

• gBlock assembly and HiFi construction.
• E.coli transformation.
• Liquid cultures.
• Miniprep.
• Qubit.

Experimental validation of GreenFET1J (BBa_K1586000):

Once the toeholds had been constructed, it was time to begin characterisation. Firstly, initial testing of the toehold's response to various amounts (including no trigger) of the correct trigger (TrigGreen; GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) was carried out. The point of this experiment was to show that GreenFET1J works as expected, i.e. as more of the correct trigger is added, GFP production increases.

To carry out this experiment, six S30 cell free reactions were set up following the S30 cell free SOP. In these reactions, 0.5 pmols of GreenFET1J (BBa_K1586000) as plasmid DNA was added to five of the reactions, and 0.5 pmols of BBa_R0040 (negative GFP control) was added to another. To the reactions containing GreenFET1J plasmid, the following amounts of TrigGreen were added; 0ng, 0.21ng, 52.31ng, 1046.09ng, and 2615.225ng. All reactions were then made up to a total volume of 50μl with nuclease-free water and incubated at 37C for three hours, after which fluorescence was read by the FLUOstar Omega reader (BMG). Repeats of this data were limited by the cost of the cell-free kits that we were using and time.

For a discussion of the full results collected, visit the results page.

• S30 cell-free kit.

• Lab Book

Adaptability towards different triggers:

An important aspect of the concept for our diagnostic test is that the focus of the test can be easily changed from one organism to another. The way in which this can be done is by changing the switch region of the toehold to bind a different trigger RNA from the organism being detected. Again, the utilities tool on NUPACK can be used to determine whether changing the switch region of the toehold would negatively affect the overall toehold structure. Once the new switch (and corresponding linker sequences) have been determined, these changes can be implemented into the current toehold structure using Q5 mutagenesis. Primers have been designed using NEB's base-changer tool (figure 1) which would allow the site-directed mutagenesis of the switch and corresponding linker region of the Zeus toehold into a switch region which could detect the same trigger RNA as Green_FET1, however due to time constraints this could not be validated experimentally in the lab. Although the changing of Zeus's target could not be shown, Q5 site-directed mutagenesis was successfully carried out in order to remove an illegal stop codon from the linker-end region of Zeus, and to remove an illegal PstI site from the GFP protein coding region of Green_FET1.

• Q5 site-directed mutagenesis.