Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Line 8: | Line 8: | ||
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.<br> | ||
<br>5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA | <br>5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA | ||
− | <br> tail homologie PHO85 | + | <br> tail homologie PHO85 |
<br>TCCATACATTTTGATGGC -3’ | <br>TCCATACATTTTGATGGC -3’ | ||
− | <br> | + | <br> Primer Kan |
<br> | <br> | ||
Revision as of 13:53, 14 August 2015