Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Line 24: | Line 24: | ||
<br><h3>Gene PHO80</h3> | <br><h3>Gene PHO80</h3> | ||
− | + | 5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. | |
<br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | <br>5’-<span style="color:#9A1717">ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATC</span><span style="color:#179A89">ATAATCATTTGCATCCAT | ||
Line 43: | Line 43: | ||
<br><h3>Gene FRT + PHO85</h3> | <br><h3>Gene FRT + PHO85</h3> | ||
− | + | 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. | |
<br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC | <br>5’-<span style="color:#9A1717">TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCG</span><span style="color:#36C40F">GAAGTTCCTATTC | ||
Line 61: | Line 61: | ||
<br> | <br> | ||
<h1>5/08/15</h1> | <h1>5/08/15</h1> | ||
− | + | irihqeih | |
</html> | </html> | ||
{{Paris_Bettencourt/footer}} | {{Paris_Bettencourt/footer}} |
Revision as of 15:20, 14 August 2015