Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
| Line 136: | Line 136: | ||
<div class="column-right"><img src="https://static.igem.org/mediawiki/2015/6/69/ParisBettencourt_Cycle_pcr_cassette_kanR.png" width="550px"> | <div class="column-right"><img src="https://static.igem.org/mediawiki/2015/6/69/ParisBettencourt_Cycle_pcr_cassette_kanR.png" width="550px"> | ||
| − | <p class="legend"><b>Figure 1:</b> | + | <p class="legend"><b>Figure 1:</b> PCR cycle</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
<br><h1>August 13rd</h1> | <br><h1>August 13rd</h1> | ||
| − | <h2>PCR | + | <h2>PCR Purification</h2> |
<B>Protocol : </B> | <B>Protocol : </B> | ||
| − | <li><u>Dilute</u> PCR product | + | <li><u>Dilute</u> PCR product 5 with the resuspension buffer<br></li> |
<li><u>Pour</u> it in a purification column<br></li> | <li><u>Pour</u> it in a purification column<br></li> | ||
<li><u>Centrifuge</u> 30sec at 14K rpm<br></li> | <li><u>Centrifuge</u> 30sec at 14K rpm<br></li> | ||
| Line 166: | Line 166: | ||
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/e/e0/ParisBettencourt_ElectrophoresisPCRKanResistance.png" width="350px"><br> | ||
| − | <p class="legend"><b>Figure 2:</b>Result of PCR | + | <p class="legend"><b>Figure 2:</b>Result of PCR</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 210: | Line 210: | ||
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br> | We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br> | ||
<br><br><br><br><br><br> | <br><br><br><br><br><br> | ||
| − | The positive control is well, yeast | + | The positive control is well, yeast multiply of YPD agar without antibiotic. Yeast is not dead, so the culture on other agar mediums are not a contamination.<br><br> |
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br> | We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br> | ||
We look only few colonies in the plates with yeast transforming PHO80.<br><br> | We look only few colonies in the plates with yeast transforming PHO80.<br><br> | ||
| − | The result is | + | The result is well, transformation works.</div> |
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"><br> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"><br> | ||
<p class="legend"><b>Figure 3:</b>Negative control</p> | <p class="legend"><b>Figure 3:</b>Negative control</p> | ||
<img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | <img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | ||
| − | <p class="legend"><b>Figure 4:</b> | + | <p class="legend"><b>Figure 4:</b>Positive control and Result of transformation</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 247: | Line 247: | ||
<h2>Problem of FRT</h2> | <h2>Problem of FRT</h2> | ||
| − | The transformation with the FRT | + | The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for <i>E. coli</i>. We can't use this plasmid, it will be rejected by yeast.<br> |
Other transformtion with Cre lox is possible.<br> | Other transformtion with Cre lox is possible.<br> | ||
Cre lox: is a gene which has the same fonction FRT, it not cup thanks to the flipase but thanks to the Cre recombinase.<br><br> | Cre lox: is a gene which has the same fonction FRT, it not cup thanks to the flipase but thanks to the Cre recombinase.<br><br> | ||
Revision as of 10:21, 19 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
August 8th
Design primers
Gene PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’
- tail homology PHO85
- Primer Kanamycin
Gene PHO80
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’
- tail homology PHO80
- Primer Kanamycin
Gene FRT + PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- tail homology PHO85
- FRT
- Primer Kanamycin
August 12nd
Culture
Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.
PCR
3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:
PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 
Figure 1: PCR cycle
August 13rd
PCR Purification
Protocol :- Dilute PCR product 5 with the resuspension buffer
- Pour it in a purification column
- Centrifuge 30sec at 14K rpm
- Throw the filtrat
- Add 700µL of EtOH (washing solution)
- Centrifuge 30sec at 14K rpm
- Throw the filtrat
- Add 500µLof washing solution
- Centrifuge 30sec at 14K rpm
- Throw the filtrat
- Centrifuge 30sec at 14K rpm
- Throw the filtrat
- Put the column in a Eppendorf
- Add 45µL of RNAse/DNAse free water right on the membrane
- Wait 2min
- Centrifuge 2min at 10K rpm
PCR control with an electrophoresis
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.
Figure 2:Result of PCR
Pre-culture
Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.
August 14th
Transformation of yeast
Protocol :- After growth, determine the titer of the yeast culture by using spectrophotometer : pipette 10µL of cells into 1mL of wtaer in spectrophotometer cuvette and measure the OD at 600nm.
- Add 2.5x108 cells to 50mL of 2X YPD in a culture flask.
- Incubate the flask in a shaking incubator at 30°C until the cell culture is at least 2x107 cells.mL-1
- Denature 1mL of carrier DNA at 99°C for 5min and chill immediately in ice.
- Harvest the yeast cells by centrifugation at 3,000g for 5min.
- Resuspend the pellet in 25mL of sterile water and centrifuge at 3,000g for 5min at 20°C. Repeat this wash with sterile water 2 times.
- Resuspend the last pellet in 1mL of sterile water.
- Transfer the cell suspension to a 1.5mL microcentrifuge tube.
- Centrifuge for 30s at 13,000g and discard the supernatant.
- Resuspend the cells in 1mL of sterile water and pipette 100µL samples into 1.5mL microcentrifuge tubes, one for each transformation.
- For each transformation :
- 240µL of PEG 3350 (50% (w/v))
- 36µL of LiAc 1.0M
- 50µL of single-stranded carrier DNA (2.0mg.mL-1)
- 6µL of PCR product
- 28µL of water DNAse Free
- Place the tubes at 42°C for 40min.
- Centrifuge the tubes at 13,000g for 30s in a microcentrifuge tube and remove the supernatant.
- Pipette 1mL of YPD liquid medium into the transformation tube, and vortex mix to resuspend pellet.
- Incubate 3h at 30°C to ensure good antibiotic expression.
- Plate 2, 20 and 200µL of the cell suspension onto YPD medium with 200µm.mL-1 antibiotic G418.
- Incubate the plates at 30°C for 3 days.
August 17th
Result of plates:
There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.
The positive control is well, yeast multiply of YPD agar without antibiotic. Yeast is not dead, so the culture on other agar mediums are not a contamination.
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.
We look only few colonies in the plates with yeast transforming PHO80.
The result is well, transformation works.
Figure 3:Negative control
Figure 4:Positive control and Result of transformation
Verification of the results
Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG
August 18th
Verification of the new negativ control
The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.
Figure 5:Result of the new negative control
Problem of FRT
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid, it will be rejected by yeast.
Other transformtion with Cre lox is possible.
Cre lox: is a gene which has the same fonction FRT, it not cup thanks to the flipase but thanks to the Cre recombinase.
We creates two primer for the new transformation with Cre lox.
Primer 5'-3' Cre lox + PHO 85
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’
Primer 3'-5' Cre lox + PHO 85
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’
- tail homology PHO85
- Cre lox
- Primer Kanamycin
August 19th
- Dilute PCR product 5 with the resuspension buffer
