There is a typical metaphor in the field of synthetic biology that compares bacteria to tiny factories, capable of creating copies of themselves. The reality is more complicated, because we are working with a living organism.

We want to gain trust from the population, and for that the technology should belong to everyone. In a way similar to the open-source software industry, people should be able to improve our project or create forks of it. This idea of openness is very common among the community of synthetic biologists, but a lot of pitfalls have to be overcome to make it a sustainable reality.

A parallel could be drawn with electronics in the 1960's, when computer programming was extremely low-level and belonged to the realm of academia. Since then, it has reached a way wider population, thanks to the creation of frameworks allowing for abstraction of the most technical parts. How could the same principles be applied to synthetic biology, in the context of metabolic engineering and vitamins production?

Even though a lot of lab strains designed for easier modification have been designed in the past, they usually have a very general purpose and biotechnology remains a matter of specialists where every modification has to be made from scratch. We imagined a repurposed organism made especially for the quick construction of these self-replicative tiny factories, that could be easily used by startups, community labs or just by enthusiasts. In the following section we discuss the constraints associated with it, and what such an organism could look like.

Specification

From the lab to the world

All in one

make manufacturing simpler only one production line

An extensible chassis

limit R&D expenses

https://static.igem.org/mediawiki/2015/9/98/PB_framework_construction.png

Our design

Overview

It seems impossible to make a strain that fullfills its nutrient-producing functions while growing as fast as the wild type, so we found a workaround: the cells that people use are not the cells that people grow. We embedded a differentiation system into our organism, so the vitamin-producing pathways are only expressed after a recombination event. The cells that are grown are almost identical to the wild-type cells. The battle against contaminants is now a fair fight.

https://static.igem.org/mediawiki/2015/8/88/PB_growth.png

It is inspired by the Brainbow system, initially developed for tracking the axons of neurons in mammalian's brain. We modified it so it becomes extensible.

This system is randomized on a single-cell level, so each cell produce one, and only one, vitamin pathway. Having one cell expressing only one pathway should theoretically preclude unexpected interactions between different pathways, thus making an extensible framework where every synthesis function is decoupled.

How does this all work?

The chassis

https://static.igem.org/mediawiki/2015/1/14/PB_chassis.png

Constitutive promoter

The Lox Array Each lox site is made of one overlap region surrounded by two complementary flanking regions. The flanking regions cannot be mutated and determine the specificity for one recombination enzyme. The overlap region can be modified, but two LoxP sites will recombine together only if it's identical for both. (richier 2015) LoxP: ATAACTTCGTATAATGTATGCTATACGAAGTTAT Lox2272: ATAACTTCGTATAAAGTATCCTATACGAAGTTAT LoxN: ATAACTTCGTATAAGGTATACTATACGAAGTTAT Lox5171: ATAACTTCGTATAATGTGTACTATACGAAGTTAT

The ID gene

The landing pad Landing pad A: attB: GTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCA attP: AGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGT

Landing pad B: attB: GTGCGGGTGCCAGGGCGTGCCCCCGGGCTCCCCGGGCGCGTACTCCA attP: AGTGCCCCAACTGGGGTAACCTCCGAGTTCTCTCAGTTGGGGGCGT

CRE-recombinase

Division of labour

Three different strains mean three different production lines at least three sterile incubators. Having only one strain that does everything hugely simplifies the process, because only one bioreactor and one production line is needed. This makes it accessible to community labs or NGOs that would want to start producing their own version of our product.

https://static.igem.org/mediawiki/2015/6/65/PB_brainbow.png

Chemical / Absence of chemical

Heat

Light

Constitutive

leakiness

decoupling the different metabolic pathways

Landing pads

quick forking in a lot of parallel projects

Genetic stability

Now we protected our product against foreign organisms, but one threat remains: our organism's own mutants. If a mutation occurs in the active site of an enzyme, or in the promoter of an operon, the functionality of the organism might be impaired. Moreover, the ID gene doesn't account for this.

How can we prevent our organism from mutating?

Fortunately, our friends at the Vanderbilt University iGEM team worked precisely on that problem this summer. We worked hand in hand with them to see what a real-life application of their invention would mean practically.

Results

Construction of the system

We succesfully assembled a prototype version of this system in the model bacteria Escherichia coli. The genes involved in vitamin production are replaced with fluorescent proteins, allowing for easy monitoring of their production. Our construct contains mCherry as a reporter gene, and two other fluorescent proteins to mimick pathways operons. It also has a phage PhiC31 integration site for subsequent addition of new genes.

https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png

This cassette was constructed by Gibson Assembly and assembled in a self-integrating plasmid vector which integrates in the site of the phage HK022 in E. coli's chromosome. This plasmid was electroporated in the bacteria and the phage HK022 integrase was induced.

Integration in the bacterial cells

To check that the cassette has correctly been integrated in the right locus, we performed an analytical PCR on the whole genome of the transformants, with a set of four primers mixed altogether.

Integrity of the cassette

fluorescent proteins are present

Sequencing of the Lox Array

To investigate whether unexpected recombination occured within the LoxP sites due to homologous recombination, we performed sequencing on the first part of the integrated cassette, where the Lox Array is. This way we could make sure that it was still intact.

Function of the promoter

BBa_K1678005

The LoxP array does not theoretically interfere with translation, as in prokaryotes the 30S subunit of the ribosome binds directly to the ribosome binding site even if it is not right at the beginning of the mRNA transcript. It can however interfere with the transcription. During the transcription, the RNA polymerase has to go through the LoxP array, which is made of repetitive sequences that are likely to form a hairpin. We show that this has an impact on the transcription efficiency (Mann-Whitney test, p-value < 10^-6), as the amount of protein is reduced on average by 9%. However, it still allows for strong protein expression and the 91% of RNA polymerases that get through should be more than enough for our design.

We have also sequenced it.

When integrated (Mann-Whitney test, p-value < 10^-6)

suitability for quality control DIlambda

Induction of the differentiation

https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png

Effects on growth

Outlook

link