Team:Paris Bettencourt/Notebook/Phytase

Background

Aims

Results

Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.

5/08/15


5Design primers

5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
tail homologie PHO85
TCCATACATTTTGATGGC -3’
Primer Kan 3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast. 3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG tail homologie PHO85 CGACCAGCATTC-5’ Primer Kan 5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. 5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT tail homologie PHO80 ACATTTTGATGGC-3’ Primer Kan 3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast. 3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA tail homologie PHO80 GCATTC-5’ Primer Kan 5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. 5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC tail homologie PHO85 TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’ FRT Primer Kan 3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85. 3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT tail homologie PHO85 GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’ FRT Primer Kan