Team:Paris Bettencourt/Notebook/Phytase
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
Phytase
August 8th
Design primers
Gene PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’
- Tail homology PHO85
- Primer Kanamycin
Gene PHO80
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’
- Tail homology PHO80
- Primer Kanamycin
Gene FRT + PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- Tail homology PHO85
- FRT
- Primer Kanamycin
August 12nd
Culture
Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.
PCR
3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:
PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 Figure 1: PCR cycle
August 13rd
PCR Purification
Protocol : PCR purification
PCR control with an electrophoresis
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.
Figure 2:Result of PCR
Pre-culture
Swo one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.
August 14th
Transformation of yeast
Protocol: Heat shock transformation for yeastAugust 17th
Result of plates:
There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.
We look only few colonies in the plates with yeast transforming PHO80.
The result is well, transformation works.
Figure 3:Negative control
Figure 4:Positive control and Result of transformation
Verification of the results
Thanks to the colony PCR, to determinate if the resistance is integrated.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG
August 18th
Verification of the new negativ control
The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.
Figure 5:Result of the new negative control
Problem of FRT
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with Cre lox system is possible.
Cre lox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.
We create two primers for the new transformation with Cre lox.
Primer 5'-3' Cre lox + PHO 85
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’
Primer 3'-5' Cre lox + PHO 85
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’
- tail homology PHO85
- Cre lox
- Primer Kanamycin
August 19th
PCR sur colony
Protocol:
PHO80 PHO85 FRT+ PHO85 dreamTaq 2X (µL) 3 3 3 H2O DNAse Free (µL) 9 9 9 Colony 1 1 1 PHO80 5'Primer (µL) 0.5 PHO80 3'Primer (µL) 0.5 PHO85 5'Primer (µL) 0.5 0.5 PHO85 3'Primer (µL) 0.5 0.5 Figure 6: PCR colony cycle
August 20th
Electrophoresis control PCR
Figure 7: Electrophoresis PCR colony