Team:Paris Bettencourt/Sustainability/Continuity
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
In order to gain trust from the population, the technology should belong to everyone. In a way similar to the open-source software industry, people should be able to improve our project or create their own versions of it. This idea of openness is very common among the community of synthetic biologists, but a lot of pitfalls have to be overcome to make it a sustainable reality.
A parallel could be drawn with electronics in the 1960's, when computer programming was extremely low-level and belonged to the realm of academia. Since then, it has reached a way wider population, thanks to the creation of frameworks allowing for abstraction of the most technical parts. How could the same principles be applied to synthetic biology, in the context of metabolic engineering and vitamins production?
Even though a lot of lab strains designed for easier modification have been designed in the past, they usually have a very general purpose and biotechnology remains a matter of specialists where every modification has to be made from scratch. We imagined a repurposed organism made especially for the quick construction of these self-replicative tiny factories, that could be easily used by startups, community labs or just by enthusiasts. In the following section we discuss the constraints associated with it, and what such an organism could look like.
For the product to be usable, several specifications have to be taken into account:- It must be easily extendable:
Our micro-organism should be a chassis allowing for quick addition of standard cassettes - It must be modular:
The different metabolic pathways should be independant so they can be put together without going through tedious troubleshooting, - It must survive in the real world:
To make our micro-organism more resistant to contamination, we need to design it so our modifications come with a minimal fitness cost. - It must be all-in-one:
For people with limited equipment, having only one strain that does everything is a huge advantage, because only one bioreactor and one production line is needed. This makes it accessible to community labs or NGOs that would want to start producing their own version of our product.
Specification
All in one
make manufacturing simpler only one production line
An extendable chassis
limit R&D expenses
https://static.igem.org/mediawiki/2015/9/98/PB_framework_construction.png
Our design
From the lab to the world
For a biological product to leave the benches and actually reach the population, it's essential to foresee its life in the hands of the people who will cultivate it and make sure it stays alive all along. Our design must therefore provide strategies to create an durable, usable product. On paper, the plan is simple: the manufacturers grow the micro-organism, distribute it and save a little fraction to start a new culture with. This could in principle last forever, but in reality the universal rules of biology soon kick back in.
Let's consider the following scenario: a wild type organism sneaks into the incubator and starts to replicate along with the engineered organism. Our microbe cannot compete: this contaminant has been selected precisely for its ability to sneak into environments and replicate, during hundreds of years, while our microbe has the burden of producing tons of enzymes to make the precious vitamins. Additionally, unnatural proteins and metabolites can have toxic effects when their production rate is high. After a couple of growth cycle, the worst seems unavoidable: the micro-organism that will be distributed will not be the right one. Not only this one doesn't produce nutrients, but it might not ferment the rice well or even be pathogenic.
These contamination events bring a lot of hassle for the manufacturer, so our design must provide solutions for making them as rare as possible.
Our approaches is based on two strategies:
- Reducing the fitness burden: To make our micro-organism more resistant to contamination, we need to design it so our modifications come with a minimal fitness cost.
- Identifying the contamination: If a contamination occurs, it is essential that it does not go unnoticed. Our design must allow the manufacturer to detect contamination, and check that what he is growing is exactly what he wants to grow.
It seems impossible to make a strain that fullfills its nutrient-producing functions while growing as fast as the wild type, so we found a workaround: the cells that people use are not the cells that people grow.
We embedded a differentiation system into our organism, so the vitamin-producing pathways are only expressed after a recombination event. First, the cells that are grown are almost identical to the wild-type cells. Before distribution, the differentiation is induced and the cells start to produce vitamins in high quantity. The battle against contaminants is now a fair fight.We protected our product against foreign organisms, but one threat remains: our organism's own mutants. If a mutation occurs in the active site of an enzyme, or in the promoter of an operon, the functionality of the organism might be impaired. How can we prevent our organism from mutating?
Fortunately, our friends at the Vanderbilt University iGEM team worked precisely on that problem this summer. We worked hand in hand with them to see what a real-life application of their invention would mean practically. They invented an algorithm to scan the sequences looking for regions that are likely to mutate, and proposed alternative versions of our sequences.
As they worked on this project while we were working on ours, we obviously could not use their optimized sequences for our constructs. However, we relied on gene synthesis for a lot of parts, so it would not have been a problem to use the optimized sequences instead. Their algorithm is therefore a valuable tool for any synthetic biologist willing to create durable products, and we applaud their work.
caption
Our differentiation system is inspired by the Brainbow system, initially developed for tracking the axons of neurons in mammalian's brain. We modified it so it becomes extendable.
This system is randomized on a single-cell level, so each cell produce one, and only one, vitamin pathway. Having one cell expressing only one pathway should theoretically preclude unexpected interactions between different pathways, thus making an extendable framework where every synthesis function is decoupled.
https://static.igem.org/mediawiki/2015/9/98/PB_framework_construction.png
How is it possible?
The chassis
Before addition of any metabolic pathways, this is what our empty chassis would look like. The following cassette is integrated in the chromosome.All proteins' coding regions are followed by a terminator.
Constitutive promoter: Thanks to this promoter, a RNA transcript of the cassette will be produced until the first terminator is reached.
The Lox Array:
The original LoxP site comes from the phage P1.
When an enzyme called the CRE recombinase is expressed, all the DNA between two Lox sites is deleted. Each lox site is made of one overlap region (in bold) surrounded by two complementary flanking regions. The middle of the sequence can be modified, but two LoxP sites will recombine together only if the sequence is exactly identical for both (Richier 2015). The flanking regions cannot be mutated and determine the specificity for one recombination enzyme.Here are the four orthogonal Lox sites we used:
- LoxP: ATAACTTCGTATAATGTATGCTATACGAAGTTAT
- Lox2272: ATAACTTCGTATAAAGTATCCTATACGAAGTTAT
- LoxN: ATAACTTCGTATAAGGTATACTATACGAAGTTAT
- Lox5171: ATAACTTCGTATAATGTGTACTATACGAAGTTAT
The ID gene: This gene is entirely optional but can be used as a barcode to identify the strain. This allows for quality control of what is inoculated when a new production culture is started.
The landing pad:
This part allows for easy integration of new gene cassettes into the system.
CRE-recombinase: The CRE recombinase should be integrated in the chromosome as well, so we do not have to use an antibiotic for maintaining the plasmid. It has to be under the control of an inducible promoter. The expression of CRE will trigger the differentiation.The Landing Pad
Starting from this chassis, up to four metabolic pathways can be added by using the attB sequence as a landing pad. Like the Lox sites, this sequence comes from a bacteriophage: the PhiC31 phage who uses it to integrate itself in the genome of the host. To insert a new sequence in it, all you need to do is build a plasmid with the matching "attP" site and express the PhiC31 integrase.
- attB: GTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCA
- attP: AGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGT
For clarity, the selection method has not been depicted. Using CRISPR-based system for selection could be a good idea as it avoids the problem of antibiotic resistance removal.
Division of labour
https://static.igem.org/mediawiki/2015/6/65/PB_brainbow.png
Chemical / Absence of chemical
Heat
Light
Constitutive
leakiness
decoupling the different metabolic pathways
Results
Construction of the system
We succesfully assembled a prototype version of this system in the model bacteria Escherichia coli. The genes involved in vitamin production are replaced with fluorescent proteins, allowing for easy monitoring of their production. Our construct contains mCherry as a reporter gene, and two other fluorescent proteins to mimick pathways operons. It also has a phage PhiC31 integration site for subsequent addition of new genes.
https://static.igem.org/mediawiki/2015/8/8f/PB_colibow_sequence.png
This cassette was constructed by Gibson Assembly and assembled in a self-integrating plasmid vector which integrates in the site of the phage HK022 in E. coli's chromosome. This plasmid was electroporated in the bacteria and the phage HK022 integrase was induced.
Integration in the bacterial cells
To check that the cassette has correctly been integrated in the right locus, we performed an analytical PCR on the whole genome of the transformants, with a set of four primers mixed altogether.
Integrity of the cassette
fluorescent proteins are present
Sequencing of the Lox Array
To investigate whether unexpected recombination occured within the LoxP sites due to homologous recombination, we performed sequencing on the first part of the integrated cassette, where the Lox Array is. This way we could make sure that it was still intact.
Function of the promoter
BBa_K1678005The LoxP array does not theoretically interfere with translation, as in prokaryotes the 30S subunit of the ribosome binds directly to the ribosome binding site even if it is not right at the beginning of the mRNA transcript. It can however interfere with the transcription. During the transcription, the RNA polymerase has to go through the LoxP array, which is made of repetitive sequences that are likely to form a hairpin. We show that this has an impact on the transcription efficiency (Mann-Whitney test, p-value < 10-6), as the amount of protein is reduced on average by 9%. However, it still allows for strong protein expression and the 91% of RNA polymerases that get through should be more than enough for our design.
We have also sequenced it.
When integrated (Mann-Whitney test, p-value < 10-6)suitability for quality control DIlambda
Induction of the differentiation
https://static.igem.org/mediawiki/2015/c/c1/PB_empty.png
Effects on growth
Outlook
link
Attribution
This project was designed and accomplished by Antoine Vigouroux in consultation with Jason Bland and Ihab Boulas. Most of the strains (DH5alpha, Top10, NEB turbo, Pir116) were kindly provided by Inserm U1001. Plasmids pFHC2938 and pMEV250 were provided by Jason Bland and Aleksandra Nivia at Didier Mazel's lab at Institut Pasteur. Plasmids pL1F2 and pR6K-shortened were provided by Antoine Decrulle and Ihab Boulas at Inserm U1001. The pIT5-KH vector was provided by Lun Cui at David Bikard's lab at Institut Pasteur. Special thanks to all the people who gave me an hand during this project, and all the Paris Bettencourt team for making it so much fun. - It must be easily extendable:
