Team:Hamburg/Composite Part
Composite Parts
constitutive promoter and miRNA
Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as an important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).
![](https://static.igem.org/mediawiki/2015/b/b2/Hamburg_parts6.jpg)
BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.
![](https://static.igem.org/mediawiki/2015/d/d2/Hamburg_parts5.jpg)
Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)
5'
GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
GroEL promoter and blue Pigment
Also for establishing a heat-inducible cell lysis system (GroEL and PezT, figure 3) we started to create an intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100) (figure 4). Future work would target a BioBrick of GroEL and PezT.
![](https://static.igem.org/mediawiki/2015/9/9e/Hamburg_parts7.jpg)
BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.
Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)
5'
GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctt tgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactac ttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacac ttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG
3'
![](https://static.igem.org/mediawiki/2015/0/09/Hamburg_parts8.jpg)