Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Cloepierson (Talk | contribs) |
Cloepierson (Talk | contribs) |
||
| Line 155: | Line 155: | ||
<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification </a> | <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification </a> | ||
<br> | <br> | ||
| − | <h2>Result of PCR (August | + | <h2>Result of PCR (August 12th)</h2><br> |
<br> | <br> | ||
| − | <div class="column-right"><p>We expected bands around 1.300bp. | + | <div class="column-right"><p>The PCR product are then revealed with a<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Gel_Electrophoresis"> gel electrophoresis.</a><br> |
| + | We expected bands around 1.300bp. | ||
The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.</p><br></div> | The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.</p><br></div> | ||
| Line 190: | Line 191: | ||
<div class="column-left"><img src="https://static.igem.org/mediawiki/2015/c/c7/Paris-bettencourt-controle884.png" width="300px"><br> | <div class="column-left"><img src="https://static.igem.org/mediawiki/2015/c/c7/Paris-bettencourt-controle884.png" width="300px"><br> | ||
| − | <p class="legend"><b>Figure 3 :</b>Negative control</p> | + | <p class="legend"><b>Figure 3 : </b>Negative control</p> |
<img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | <img src="https://static.igem.org/mediawiki/2015/b/b8/Paris-bettencourt-g%C3%A9lose65.png" width="300px"> | ||
| − | <p class="legend"><b>Figure 4 :</b>Positive control and | + | <p class="legend"><b>Figure 4 : </b>Positive control and result of transformation</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| − | <h2> | + | <h2>Design primers</h2> |
| − | Thanks to the colony PCR, | + | We design primers to verifie our results on the plates.<br> |
| + | Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.<br> | ||
Create the primer:<br> | Create the primer:<br> | ||
Primer 5'-3' PHO80<br> | Primer 5'-3' PHO80<br> | ||
| Line 223: | Line 225: | ||
<div class="column-left"> | <div class="column-left"> | ||
| − | <img src="https://static.igem.org/mediawiki/2015/d/d8/Paris-bettencourt-g%C3%A9lose655584848.png" width="200px"><p class="legend"><b>Figure 5 :</b>Result of the new negative control | + | <img src="https://static.igem.org/mediawiki/2015/d/d8/Paris-bettencourt-g%C3%A9lose655584848.png" width="200px"><p class="legend"><b>Figure 5 : </b>Result of the new negative control |
</p></div> | </p></div> | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| Line 230: | Line 232: | ||
<p> | <p> | ||
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for <i>E. coli</i>. We can't use this plasmid because it will be rejected by the yeast.<br> | The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for <i>E. coli</i>. We can't use this plasmid because it will be rejected by the yeast.<br> | ||
| − | Other transformation with | + | Other transformation with CreLox system is possible.<br> |
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase. | CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase. | ||
</p><br><br> | </p><br><br> | ||
| Line 255: | Line 257: | ||
<br><h1 class="date one">August 19th</h1> | <br><h1 class="date one">August 19th</h1> | ||
| − | <h2>PCR | + | <h2>Colony PCR</h2> |
<b>Protocol:</b> | <b>Protocol:</b> | ||
<br> | <br> | ||
| Line 318: | Line 320: | ||
<br><h1 class="date one">August 20th</h1> | <br><h1 class="date one">August 20th</h1> | ||
| − | <h2> | + | <h2>Result of colony PCR (August 19th)</h2> |
<div class="column-left"><br><br><p> | <div class="column-left"><br><br><p> | ||
We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony. | We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony. | ||
| Line 329: | Line 331: | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
| − | <br><h2>PCR | + | <br><h2>Colony PCR</h2> |
Same to August 19th. | Same to August 19th. | ||
Revision as of 18:35, 29 August 2015
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
-
Vitamin A Vitamin B2 Vitamin B12 Phytase Riboswitch Differentiation on E. coli Differentiation on S. cerevisiae Manufacturing Idli and Micro-organisms August 8th
Design primers
Gene PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’
- Homology tail on gene PHO85
- Kanamycin resistance binding
Gene PHO80
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’
- Homology tail on gene PHO80
- Kanamycin resistance binding
Gene FRT + PHO85
5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding
August 12nd
Culture
Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.
PCR
3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:
PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 
Figure 1 : PCR cycle
August 13th
PCR Purification
Protocol : PCR purification
Result of PCR (August 12th)
The PCR product are then revealed with a gel electrophoresis.
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.
Figure 2 :Result of PCR
Pre-culture
Plated one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.
August 14th
Transformation of yeast
Protocol: Heat shock transformation for yeastAugust 17th
Result of plates:
There is a culture in plates.
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.
We look only few colonies in the plates with yeast transforming PHO80.
The result is well, transformation works.
Figure 3 : Negative control
Figure 4 : Positive control and result of transformation
Design primers
We design primers to verifie our results on the plates.
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.
Create the primer:
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG
Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC
Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG
Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG
Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG
August 18th
Verification of the new negative control
The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.
Figure 5 : Result of the new negative control
FRT problems
The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with CreLox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.
We design two primers for the new transformation with CreLox system.
Primer 5'-3' CreLox + PHO85
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’
Primer 3'-5' CreLox + PHO85
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’
- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding
August 19th
Colony PCR
Protocol:
PHO80 PHO85 FRT+ PHO85 dreamTaq 2X (µL) 3 3 3 H2O DNAse Free (µL) 9 9 9 Colony 1 1 1 PHO80 5'Primer (µL) 0.5 PHO80 3'Primer (µL) 0.5 PHO85 5'Primer (µL) 0.5 0.5 PHO85 3'Primer (µL) 0.5 0.5 
Figure 6 : Colony PCR cycle
August 20th
Result of colony PCR (August 19th)
We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony.
Figure 7 : Electrophoresis PCR colony
Colony PCR
Same to August 19th.Electrophoresis control PCR
Figure 8 : second electrophoresis PCR colony
The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.
August 24th
Yeast lysis with NaOH
Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.
August 25th
PCR Verification
Electrophoresis control PCR
Figure 9 : Third electrophoresis PCR colony with NaOH lysis
The DNA ladder migrate, but there was any amplification of the both genes.
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of OH plasmid and the oligos using for PHO85 gene.August 26th
Colony PCR
To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the " DNeasy Blood and Tissue Kit" with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.
Phytic acid dosage
We dose the phytic acid in the fermented rice with the kit " Phytic Acid (Total Phosphorus) Assay Kit ".August 27th
Electrophoresis control PCR
Figure 10 : Electrophoresis colony PCR with temperature gradient on non-transformed yeasts lysed by the zymolyase
We made a PCR gradient on non-transformed yeast to know exactly wich temperature is better to a good fixation of the primers on the DNA.
The amplification failed, we supposed it is because our MasterMix did not work. We will try this PCR again.Phytic acid dosage
We dose the phytic acid in fermented rice.
Figure 12 : Acid phytic dosage on fermented rice
Second electrophoresis control PCR
Figure 11 : Second electrophoresis PCR colony with temperature gradient (non-transformed yeast)
We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.
We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.August 28th
Phytic acid dosage in different strains
Figure 13 : Acid phytic dosage on fermented rice with some strains
Figure 14 : Results of acid phytic dosage on fermented rice
Electrophoresis PCR
Figure 15 : Third electrophoresis gradient PCR (non-transformed yeast)
We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.
The controle postive with the OH plasmid worked, the band matches with the PHO85 gene size (1020bp).
Figure 16 : Electrophoresis PCR transformed yeasts
BLA BLA
