Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

Line 184: Line 184:
 
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.<br> We will repeat this control on an agar plate and not in a liquid medium.<br><br>
 
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.<br> We will repeat this control on an agar plate and not in a liquid medium.<br><br>
 
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br>
 
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br>
−
<br><br><br><br><br><br>
+
<br><br><br><br><br>
 
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.<br><br>
 
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.<br><br>
 
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br>
 
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br>
Line 201: Line 201:
 
We design primers to verifie our results on the plates.<br>
 
We design primers to verifie our results on the plates.<br>
 
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.<br>
 
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.<br>
−
Create the primer:<br>
+
 
 
Primer 5'-3' PHO80<br>
 
Primer 5'-3' PHO80<br>
−
<span style="color:#179A89">ATCATAAGACGAGGATATCCTTTGGAG</span><br>
+
<span style="color:#179A89">ATCATAAGACGAGGATATCCTTTGGAG</span><br><br>
 
Primer 3'-5' PHO80<br>
 
Primer 3'-5' PHO80<br>
−
<span style="color:#179A89">CTCAATCATGATTGCTTTCATAATACCCC</span><br>
+
<span style="color:#179A89">CTCAATCATGATTGCTTTCATAATACCCC</span><br><br>
 
Primer 5'-3' PHO85<br>
 
Primer 5'-3' PHO85<br>
−
<span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br>
+
<span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br><br>
 
Primer 3'-5' PHO85<br>
 
Primer 3'-5' PHO85<br>
−
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br>
+
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br><br>
 
Primer 5'-3' FRT+PHO85<br>
 
Primer 5'-3' FRT+PHO85<br>
−
<span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br>
+
<span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br><br>
 
Primer 3'-5' FRT+PHO85<br>
 
Primer 3'-5' FRT+PHO85<br>
−
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br>
+
<span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br><br>
 
   
 
   
  
Line 357: Line 357:
  
 
<br><h1 class="date one">August 25th</h1>
 
<br><h1 class="date one">August 25th</h1>
−
<h2>Result of PCR</h2>
+
<h2>Result of PCR (August 24th)</h2>
  
 
<div class="column-left">
 
<div class="column-left">

Revision as of 18:46, 29 August 2015

August 8th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- Homology tail on gene PHO85
- Kanamycin resistance binding

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- Homology tail on gene PHO80
- Kanamycin resistance binding

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.


Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

Figure 1 : PCR cycle


August 13th

PCR Purification

Protocol : PCR purification

Result of PCR (August 12th)



The PCR product are then revealed with a gel electrophoresis.
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.



Figure 2 :Result of PCR


Pre-culture

Plated one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast
Protocol: Heat shock transformation for yeast

August 17th

Result of plates:

There is a culture in plates.

The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.

We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.





The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.

We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.

We look only few colonies in the plates with yeast transforming PHO80.

The result is well, transformation works.


Figure 3 : Negative control

Figure 4 : Positive control and result of transformation

Design primers

We design primers to verifie our results on the plates.
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG

Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC

Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG

Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG


August 18th

Verification of the new negative control

The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.


Figure 5 : Result of the new negative control

FRT problems

The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with CreLox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.



We design two primers for the new transformation with CreLox system.

Primer 5'-3' CreLox + PHO85

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

Primer 3'-5' CreLox + PHO85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding

August 19th

Colony PCR

Protocol:
PHO80 PHO85 FRT+ PHO85
dreamTaq 2X (µL) 3 3 3
H2O DNAse Free (µL) 9 9 9
Colony 1 1 1
PHO80 5'Primer (µL) 0.5
PHO80 3'Primer (µL) 0.5
PHO85 5'Primer (µL) 0.5 0.5
PHO85 3'Primer (µL) 0.5 0.5

Figure 6 : Colony PCR cycle


August 20th

Result of colony PCR (August 19th)



We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony.

Figure 7 : Electrophoresis PCR colony


Colony PCR

Same to August 19th.

Result of second colony PCR

Figure 8 : second electrophoresis colony PCR

The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.


August 24th

Yeast lysis with NaOH

Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.

August 25th

Result of PCR (August 24th)

Figure 9 : Third electrophoresis colony PCR with NaOH lysis

The DNA ladder migrate, but there was any amplification of the both genes.
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of OH plasmid and the oligos using for PHO85 gene.


August 26th

Colony PCR

To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the " DNeasy Blood and Tissue Kit" with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.


Phytic acid dosage

We dose the phytic acid in the fermented rice with the kit " Phytic Acid (Total Phosphorus) Assay Kit ".

August 27th

Result of PCR (August 26th)

Figure 10 : Electrophoresis colony PCR with temperature gradient on non-transformed yeasts lysed by the zymolyase

We made a PCR gradient on non-transformed yeast to know exactly wich temperature is better to a good fixation of the primers on the DNA.
The amplification failed, we supposed it is because our MasterMix did not work. We will try this PCR again.

Phytic acid dosage

We dose the phytic acid in fermented rice.

Figure 12 : Acid phytic dosage on fermented rice

Result of second PCR

Figure 11 : Second electrophoresis colony PCR with temperature gradient (non-transformed yeast)

We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.
We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.


August 28th

Phytic acid dosage in different strains

Figure 13 : Acid phytic dosage on fermented rice with some strains


Figure 14 : Results of acid phytic dosage on fermented rice

Results of PCR

Figure 15 : Third electrophoresis gradient PCR (non-transformed yeast)


We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.
The controle postive with the OH plasmid worked, the band matches with the PHO85 gene size (1020bp).


Figure 16 : Electrophoresis PCR transformed yeasts


BLA BLA