• August
• September

August 10th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- Homology tail on gene PHO85
- Kanamycin resistance binding

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- Homology tail on gene PHO80
- Kanamycin resistance binding

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.

Protocol:

August 13th

PCR Purification

Protocol : PCR purification

Result of PCR (August 12th)

Pre-culture

Plated one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast

Protocol: Heat shock transformation for yeast

August 17th

Result of plates:

There is a culture in plates.

Design primers

We design primers to verifie our results on the plates.
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG

Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC

Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG

Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG

August 18th

Verification of the new negative control

FRT problems

The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with CreLox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.

We design two primers for the new transformation with CreLox system.

Primer 5'-3' CreLox + PHO85

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

Primer 3'-5' CreLox + PHO85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding

August 19th

Colony PCR

Protocol:

August 20th

Result of colony PCR (August 19th)

Colony PCR

Same to August 19th.

Result of second colony PCR

August 24th

Yeast lysis with NaOH

Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.

August 25th

Result of PCR (August 24th)

August 26th

Colony PCR

To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the " DNeasy Blood and Tissue Kit" with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.

Phytic acid dosage

We dose the phytic acid in the fermented rice with the kit " Phytic Acid (Total Phosphorus) Assay Kit ".

August 27th

Result of PCR (August 26th)

Phytic acid dosage

Result of second PCR

August 28th

Phytic acid dosage in different strains

Results of PCR

Transformation

We transform the yeast Saccharomyces cerevisiae SK1 with the resistance to geneticin and the Cre gene. We delete the PHO 85 genes and we replace it by the resistance gene.

August 30th

Transformation on yeasts with Cre gene

First step, we realize the PCR of CRE and RFP gene with primers (created by Amaury) and plasmid containing RFP. We amplified the gene, its promoter and its terminater.
Protocol : PCR

Second step, we make PCR purification, and check the result with electrophoresis.
Protocol : PCR purification

Third step, we transformed yeast that is already integrated the resistance instead of PHO85 gene. We introduce the CRE and RFP gene instead of PHO80 gene
Protocol : Transformation of yeast

Fourth step, we cultived the transforming yeasts in YPD agar medium with geneticin overnight.

PCR and result

September 1st

Result of transformation

We watching any culture on plates YPD + Geneticin. The yeast are not resistant to geneticin, they had not introduced the resistance gene. Transformation does not work.

September 2nd

Transformation

We start again the transformation of august 28th, with the same protocol.

Titration of phytic acid

We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl.

September 4th

After the transformation of September 2nd, any culture is observable on plates. The tansformation are not function. We restart transformation, but we transform with Cre and RFP gene. It is more interesting because we not forced to simply remove the resistance gene, we can make a double identification. It helps to identify yeast that is already integrated in place of the resistance gene PHO85 (they cultivate on agar with geneticin) and we also integrate the RFP gene in place of PHO80 gene (they will be red).

September 8th

PCR to product Cre/RFP sequence

We restart PCR with Cre sequence and RFP gene.

Analysis of results of titration phytic acid of September 2nd

We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl. We start to do the phosphorus scale.


With calculations which are in the protocol, we have the concentration in our samples.
Protocol : Titration of phytic acid

Figure 21 : Table of results

Concentrations are very low. There are less to 1mg/100g d’idli.

September 11th

Transformation

We did the transformation on strain Saccharomyces cerevisiae SK1, using the protocol of heat shock yeast transformation.

September 14th

Genomic DNA extraction of transformed yeast

We try to extract genomic DNA of transformed yeast with the "Blood & Tissue extraction Kit"
We make PCR on it.

Result of PCR

The gel electrophoresis revealed any bands. We might suppose that the transformation did not work, but it's probably that we don't succeed to extract the yeast's DNA which prevent us to verify our results.

September 15th

Plate of yeast transformed with RFP

September 16th

Plate of yeast transformed with RFP

Test new transforms yeats

We test our new transforms yeast which lost PHO 80 gene and PHO 85 gene and compare with transformed yeast previously (first with the geneticin resistance gene in place PHO85 gene and second with the geneticin resistance gene in place PHO80) . We put this yeast in YPD + geneticin medium (YPD +genetin for always keep the selection). We have grown the yeast with six concentration of phytic acid (0.005, 0.01, 0.02, 0.04, 0.1, 0.2 g.ml-1). We also realize a scale with phytic acid and YPD+ geneticin medium.
Scale: C(phytic acid;YPD) (g.mL-1) 0,005 0,01 0,02 0,04 0,1

Figure 23 :Table manipulation

We have a problem, we don’t have enough reagents in our kit and it is too late to buy. We choose deleted three concentrations by strain and scale.

Figure 24 :New table manipulation

Figure 25 :Result of test

Result analyze: We have only absorbance result below zero. Normally is no possible. We suppose the reagents are old and it not work. Would have had to do again the tests but there is not reagents and the time anymore.