Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"
Cloepierson (Talk | contribs) |
|||
(100 intermediate revisions by 5 users not shown) | |||
Line 1: | Line 1: | ||
{{Paris_Bettencourt/header}} | {{Paris_Bettencourt/header}} | ||
{{Paris_Bettencourt/menu}} | {{Paris_Bettencourt/menu}} | ||
− | {{Paris_Bettencourt/ | + | {{Paris_Bettencourt/banner|page_id=notebook|page_name=Notebook - Phytase}} |
<html> | <html> | ||
Line 12: | Line 12: | ||
<div id="notebookContent"> | <div id="notebookContent"> | ||
− | <a name="august" class="anchor" | + | <a name="august" class="anchor"></a> |
− | <h1 class="date one">August | + | <h1 class="date one">August 10th</h1> |
<h2>Design primers</h2> | <h2>Design primers</h2> | ||
<h3>Gene PHO85</h3> | <h3>Gene PHO85</h3> | ||
Line 149: | Line 149: | ||
<p class="legend"><b>Figure 1 :</b> PCR cycle</p></div> | <p class="legend"><b>Figure 1 :</b> PCR cycle</p></div> | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
+ | |||
+ | |||
<br><h1 class="date one">August 13th</h1> | <br><h1 class="date one">August 13th</h1> | ||
<h2>PCR Purification</h2> | <h2>PCR Purification</h2> | ||
− | Protocol : | + | <b>Protocol</b> : |
<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification </a> | <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification </a> | ||
<br> | <br> | ||
<h2>Result of PCR (August 12th)</h2><br> | <h2>Result of PCR (August 12th)</h2><br> | ||
− | |||
<div class="column-right"><p>The PCR product are then revealed with a<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Gel_Electrophoresis"> gel electrophoresis.</a><br> | <div class="column-right"><p>The PCR product are then revealed with a<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Gel_Electrophoresis"> gel electrophoresis.</a><br> | ||
Line 168: | Line 169: | ||
<br><h2>Pre-culture</h2> | <br><h2>Pre-culture</h2> | ||
Plated one colony of <i>Saccharomyces cerevisiae SK1</i> in 5mL liquid YPD medium and let's grow overnight.<br> | Plated one colony of <i>Saccharomyces cerevisiae SK1</i> in 5mL liquid YPD medium and let's grow overnight.<br> | ||
+ | |||
+ | |||
<br><h1 class="date one">August 14th</h1> | <br><h1 class="date one">August 14th</h1> | ||
− | Transformation of yeast< | + | <h2>Transformation of yeast</h2> |
− | Protocol: | + | <b>Protocol</b>: |
<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> Heat shock transformation for yeast </a> | <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> Heat shock transformation for yeast </a> | ||
Line 184: | Line 187: | ||
The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.<br> We will repeat this control on an agar plate and not in a liquid medium.<br><br> | The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.<br> We will repeat this control on an agar plate and not in a liquid medium.<br><br> | ||
We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br> | We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.<br> | ||
− | + | <br><br><br><br><br> | |
The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.<br><br> | The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.<br><br> | ||
We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br> | We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.<br><br> | ||
Line 201: | Line 204: | ||
We design primers to verifie our results on the plates.<br> | We design primers to verifie our results on the plates.<br> | ||
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.<br> | Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.<br> | ||
− | + | ||
Primer 5'-3' PHO80<br> | Primer 5'-3' PHO80<br> | ||
− | <span style="color:#179A89">ATCATAAGACGAGGATATCCTTTGGAG</span><br> | + | <span style="color:#179A89">ATCATAAGACGAGGATATCCTTTGGAG</span><br><br> |
Primer 3'-5' PHO80<br> | Primer 3'-5' PHO80<br> | ||
− | <span style="color:#179A89">CTCAATCATGATTGCTTTCATAATACCCC</span><br> | + | <span style="color:#179A89">CTCAATCATGATTGCTTTCATAATACCCC</span><br><br> |
Primer 5'-3' PHO85<br> | Primer 5'-3' PHO85<br> | ||
− | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br> | + | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br><br> |
Primer 3'-5' PHO85<br> | Primer 3'-5' PHO85<br> | ||
− | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | + | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br><br> |
Primer 5'-3' FRT+PHO85<br> | Primer 5'-3' FRT+PHO85<br> | ||
− | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br> | + | <span style="color:#179A89">TATCATTATATATACATGGCTACGGTTTTTCG</span><br><br> |
Primer 3'-5' FRT+PHO85<br> | Primer 3'-5' FRT+PHO85<br> | ||
− | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br> | + | <span style="color:#179A89">AAGGGATATATAGCGCGGCAAACTG</span><br><br> |
Line 322: | Line 325: | ||
<h2>Result of colony PCR (August 19th)</h2> | <h2>Result of colony PCR (August 19th)</h2> | ||
<div class="column-left"><br><br><p> | <div class="column-left"><br><br><p> | ||
− | We | + | We see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony. There is DNA in holes too, which didn't migrate, probably the genomic DNA. |
</p></div> | </p></div> | ||
Line 334: | Line 337: | ||
Same to August 19th. | Same to August 19th. | ||
− | <br><h2> | + | <br><h2>Result of second colony PCR</h2> |
<div class="column-left"> | <div class="column-left"> | ||
<img src="https://static.igem.org/mediawiki/2015/c/c4/ParisbettencoursPCR_colony_sans_lise.png" width="550px"> | <img src="https://static.igem.org/mediawiki/2015/c/c4/ParisbettencoursPCR_colony_sans_lise.png" width="550px"> | ||
− | <p class="legend"><b>Figure 8 :</b> second electrophoresis | + | <p class="legend"><b>Figure 8 :</b> second electrophoresis colony PCR</p></div> |
Line 357: | Line 360: | ||
<br><h1 class="date one">August 25th</h1> | <br><h1 class="date one">August 25th</h1> | ||
− | <h2>PCR | + | <h2>Result of PCR (August 24th)</h2> |
− | + | ||
<div class="column-left"> | <div class="column-left"> | ||
<img src="https://static.igem.org/mediawiki/2015/0/06/ParisBettencourt_PCR_colony_25.08.png" width="550px"> | <img src="https://static.igem.org/mediawiki/2015/0/06/ParisBettencourt_PCR_colony_25.08.png" width="550px"> | ||
− | <p class="legend"><b>Figure 9 :</b> Third electrophoresis | + | <p class="legend"><b>Figure 9 :</b> Third electrophoresis colony PCR with NaOH lysis</p></div> |
<div class="column-right"><p> | <div class="column-right"><p> | ||
The DNA ladder migrate, but there was any amplification of the both genes.<br> | The DNA ladder migrate, but there was any amplification of the both genes.<br> | ||
− | We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of | + | We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of HO plasmid and the oligos using for PHO85 gene. |
</p></div> | </p></div> | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
Line 386: | Line 388: | ||
<br><h1 class="date one">August 27th</h1> | <br><h1 class="date one">August 27th</h1> | ||
− | <h2> | + | <h2>Result of PCR (August 26th)</h2> |
<div class="column-right"> | <div class="column-right"> | ||
<img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px"> | <img src="https://static.igem.org/mediawiki/2015/c/ce/ParisBettencourt_PCR_colony_gradient_27.08.png" width="550px"> | ||
Line 398: | Line 400: | ||
<h2>Phytic acid dosage</h2> | <h2>Phytic acid dosage</h2> | ||
<div class="column-right"><p> | <div class="column-right"><p> | ||
− | We dose the phytic acid in fermented rice.</p></div> | + | We dose the phytic acid in fermented rice.<br> |
+ | After analysis, the fermented rice have very little quantity of phosphorus and of phytic acid.<br> | ||
+ | <b>[Phosphorus] :</b> 0.0758 mg/100g of rice.<br> | ||
+ | <b>[Phytic acid] :</b> 0.269 mg/100g of rice.</p></div> | ||
<div class="column-left"> | <div class="column-left"> | ||
− | <img src="https://static.igem.org/mediawiki/2015/ | + | <img src="https://static.igem.org/mediawiki/2015/0/09/ParisBettencourtPhyticAcidTitration1.png" width="550px"> |
− | <p class="legend"><b>Figure | + | <p class="legend"><b>Figure 11 :</b> Phosphorus calibration curve for titration of phytic acid in fermented rice</p></div> |
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
− | <h2> | + | <h2>Result of second PCR</h2> |
<div class="column-right"> | <div class="column-right"> | ||
<img src="https://static.igem.org/mediawiki/2015/f/fe/ParisBettencourt_PCR_colony_gradient_27.08.15_%282%29.png" width="550px"> | <img src="https://static.igem.org/mediawiki/2015/f/fe/ParisBettencourt_PCR_colony_gradient_27.08.15_%282%29.png" width="550px"> | ||
− | <p class="legend"><b>Figure | + | <p class="legend"><b>Figure 12 :</b> Second electrophoresis colony PCR with temperature gradient (non-transformed yeast)</p></div> |
<div class="column-left"> | <div class="column-left"> | ||
<p>We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.<br>We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.</p></div> | <p>We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.<br>We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.</p></div> | ||
Line 417: | Line 422: | ||
<br><h1 class="date one">August 28th</h1> | <br><h1 class="date one">August 28th</h1> | ||
<h2>Phytic acid dosage in different strains</h2> | <h2>Phytic acid dosage in different strains</h2> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | <h2> | + | <img src="https://static.igem.org/mediawiki/2015/3/3c/ParisBettencourtTitrationPhyticAcidCurve2.png" width="750px"><br><br> |
+ | <img src="https://static.igem.org/mediawiki/2015/b/bb/ParisBettencourtTitrationPhyticAcidResultsOD2.png" width="1000px"> | ||
+ | <p class="legend"><b>Figure 13 :</b> Phosphorus calibration curve + results of OD in some strains</p><br> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/8/85/ParisBettencourtTitrationPhyticAcidResultsConcentration2.png" width="850px"> | ||
+ | <p class="legend"><b>Figure 14 :</b> Results of acid phytic dosage on fermented rice</p> | ||
+ | |||
+ | <h2>Results of PCR</h2> | ||
<div class="column-left"> | <div class="column-left"> | ||
<img src="https://static.igem.org/mediawiki/2015/2/2d/ParisBettencourtGel_28.08_gradient_4temp_80-85.png" width="550px"> | <img src="https://static.igem.org/mediawiki/2015/2/2d/ParisBettencourtGel_28.08_gradient_4temp_80-85.png" width="550px"> | ||
Line 430: | Line 435: | ||
</div> | </div> | ||
<div class="column-right"><p>We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.<br> | <div class="column-right"><p>We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.<br> | ||
− | The controle postive with the | + | The controle postive with the HO plasmid worked, the band matches with the PHO85 gene size (1020bp). |
</p></div> | </p></div> | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
Line 436: | Line 441: | ||
<br> | <br> | ||
<div class="column-left"> | <div class="column-left"> | ||
− | <img src="https://static.igem.org/mediawiki/2015/3/37/ParisBettencourt_Gel_28.08_Gradient_yeast_transfo_2temp_80-85-FRT.png" width=" | + | <img src="https://static.igem.org/mediawiki/2015/3/37/ParisBettencourt_Gel_28.08_Gradient_yeast_transfo_2temp_80-85-FRT.png" width="300px"> |
<p class="legend"><b>Figure 16 :</b> Electrophoresis PCR transformed yeasts</p><br> | <p class="legend"><b>Figure 16 :</b> Electrophoresis PCR transformed yeasts</p><br> | ||
</div> | </div> | ||
− | <div class="column-right"><p> | + | <div class="column-right"><p>The positive control is negative, PCR does not therefore our work. |
</p></div> | </p></div> | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
+ | <h2>Transformation</h2> | ||
+ | We transform the yeast <i>Saccharomyces cerevisiae SK1</i> with the resistance to geneticin and the <i>Cre</i> gene. We delete the PHO 85 genes and we replace it by the resistance gene.<br> | ||
+ | <div class="column-right"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/e/e7/PARISBETTENCOURT_CRE.png" width="550px"> | ||
+ | <p class="legend"><b>Figure 17 :</b>Principle of Cre recombinase</p><br> | ||
+ | </div> | ||
+ | <div class="column-left"><p><br>The <i>Cre</i> gene is the sequence that little be cut thanks Cre recombinase and recombined the gene without the sequence between the Cre sequences.</p></div> | ||
+ | <div style="clear:both"></div> | ||
+ | <br> | ||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date one">August 30th</h1> | ||
+ | <h2>Transformation on yeasts with <i>Cre</i> gene</h2> | ||
+ | First step, we realize the PCR of <i>Cre</i> and <i>RFP</i> gene with primers (created by Amaury) and plasmid containing RFP. We amplified the gene, its promoter and its terminater.<br> | ||
+ | <b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR"> PCR</a><br> | ||
<br> | <br> | ||
+ | |||
+ | Second step, we make PCR purification, and check the result with electrophoresis.<br> | ||
+ | <b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification</a> | ||
+ | <br> | ||
+ | <br> | ||
+ | Third step, we transformed yeast that is already integrated the resistance instead of PHO85 gene. We introduce the <i>Cre</i> and <i>RFP</i> genes instead of PHO80 gene<br> | ||
+ | <b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> Transformation of yeast</a><br> | ||
+ | <br> | ||
+ | Fourth step, we cultived the transforming yeasts in YPD agar medium with geneticin overnight. | ||
+ | <br><br> | ||
+ | </p> | ||
+ | |||
+ | <h2>PCR and result</h2> | ||
+ | <div class="column-left"></p>We did electrophoresis of transformation product. It's revealed bands around 10,000bp, while we expected 1,000bp. We think the DNA extraction in yeast doesn't work, and these bands are contamination.</div> | ||
+ | <div class="column-right"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/b/bf/ParisBettencourt_PCRgelRFPCRE.png" width="400px"> | ||
+ | <p class="legend"><b>Figure 18 :</b> Colony PCR on transformed yeast with RFP</p></div> | ||
+ | <div style="clear:both"></div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <a name="september" class="anchor"><h1></h1></a> | ||
+ | <br><h1 class="date two">September 1st</h1> | ||
+ | <h2>Result of transformation</h2> | ||
+ | We watching any culture on plates YPD + Geneticin. The yeast are not resistant to geneticin, they had not introduced the resistance gene. Transformation does not work. | ||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 2nd</h1> | ||
+ | <h2> Transformation</h2> | ||
+ | We start again the transformation of august 28th, with the same protocol. | ||
+ | |||
+ | <h2>Titration of phytic acid</h2> | ||
+ | We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.<br> | ||
+ | Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl. | ||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 4th</h1> | ||
+ | |||
+ | After the transformation of September 2nd, any culture is observable on plates. The tansformation are not function. We restart transformation, but we transform with <i>Cre</i> and <i>RFP</i> genes. It is more interesting because we not forced to simply remove the resistance gene, we can make a double identification. It helps to identify yeast that is already integrated in place of the resistance gene PHO85 (they cultivate on agar with geneticin) and we also integrate the RFP in place of PHO80 gene (they will be red). | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 8th</h1> | ||
+ | |||
+ | <h2>PCR to product cassette Cre/RFP</h2> | ||
+ | |||
+ | We restart PCR with Cre sequence and RFP gene.<br> | ||
+ | |||
+ | |||
+ | |||
+ | <div class="column-left"> | ||
+ | <br><img src="https://static.igem.org/mediawiki/2015/f/f3/ParisBettencourt_PCRelectrophoresisCRERFP.jpeg" width="450px"> | ||
+ | <p class="legend"><b>Figure 19 : </b>Electrophoresis of Cre and RFP amplification</p><br> | ||
+ | </div> | ||
+ | <div class="column-right"><p><br>We see only one band. We can continue experiments with this sample and realize the transformation.</p></div> | ||
+ | <div style="clear:both"></div> | ||
+ | |||
+ | |||
+ | <h2> Analysis of results of titration phytic acid of September 2nd</h2> | ||
+ | We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.<br> | ||
+ | Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl. | ||
+ | |||
+ | We start to do the phosphorus scale.<br><br> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2015/c/cb/ParisBettencourtTitrationPhyticAcidCurve3.png" width="500px"> | ||
+ | <p class="legend"><b>Figure 20 :</b> Phosphorus calibration curve</p> | ||
+ | <br> | ||
+ | With calculations of the protocol, we can determine the concentration in our samples.<br> | ||
+ | |||
+ | <b>Protocol :</b><a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#FSTitrationacidphytic"> Titration of phytic acid</a> | ||
+ | <br><br> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2015/8/8f/ParisBettencourt_TAB85jdkshdjs6255666666.png" width="600px"> | ||
+ | <p class="legend"><b>Figure 21 :</b> Table of results</p> | ||
+ | Concentrations are very low. There are less to 1mg/100g d’idli. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 11th</h1> | ||
+ | <h2>Transformation</h2> | ||
+ | We did the transformation on strain <i>Saccharomyces cerevisiae SK1</i>, using the protocol of<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#HeatShockYeast"> heat shock yeast transformation</a>. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 14th</h1> | ||
+ | <h2>Genomic DNA extraction of transformed yeast</h2> | ||
+ | We try to extract genomic DNA of transformed yeast with the <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#YeastDNAextractiondneasybloodandtissuekit"> "Blood & Tissue extraction Kit"</a> | ||
+ | <br> | ||
+ | We make PCR on it. | ||
+ | |||
+ | <h2>Result of PCR</h2> | ||
+ | The gel electrophoresis revealed any bands. We might suppose that the transformation did not work, but it's probably that we don't succeed to extract the yeast's DNA which prevent us to verify our results. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 15th</h1> | ||
+ | <h2>Plate of yeast transformed with RFP</h2> | ||
+ | <div class="column-left"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/6/60/ParsBettencourt_PlateAMAURYRFPCRE.jpeg" width="300px"> | ||
+ | <p class="legend"><b>Figure 22 :</b> Transformed <i>S. cerevisiae SK1</i> on YPD agar + geneticin</p></div> | ||
+ | <div class="column-right">Colonies are not isolated, we cannot distinguish all of them. The culture that was inoculate was too concentrate. | ||
+ | We make suspensions low concentrate and inoculate again on YPD medium with geneticin at 200µg/mL. | ||
+ | </div> | ||
+ | <div style="clear:both"></div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <br><h1 class="date two">September 16th</h1> | ||
+ | <h2>Plate of yeast transformed with RFP</h2> | ||
+ | <div class="column-left"> | ||
+ | <img src="https://static.igem.org/mediawiki/2015/9/97/ParisBettencourt_PCRgelRFPCRE1.jpeg" width="300px"> | ||
+ | <p class="legend"><b>Figure 23 :</b> Transformed <i>S. cerevisiae SK1</i> on YPD agar + geneticin</p></div> | ||
+ | <div class="column-right">All colonies are the same, but there is no red coloration.<br> | ||
+ | These result can be explicated by the fact that when this gene is introduced in the genomic DNA, it's not revealed, whereas it is in a plasmid. | ||
+ | </div> | ||
+ | <div style="clear:both"></div> | ||
+ | |||
+ | <h2>Test new transformed yeast</h2> | ||
+ | We test our new transformed yeast which deletion of PHO80 and PHO85 genes and compare with yeast transformed previously (first with the geneticin resistance gene in place PHO85 gene and second with the geneticin resistance gene in place PHO80). We put this yeast in YPD + geneticin medium (YPD + geneticinn for always keep the selection). We have grown the yeast with six concentration of phytic acid (0.005, 0.01, 0.02, 0.04, 0.1, 0.2 g/mL). We also realize a scale with phytic acid and YPD medium + geneticin. <br> | ||
+ | Scale: C(phytic acid;YPD) (g.mL-1) 0,005 0,01 0,02 0,04 0,1 <br> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2015/1/15/PariBettencourt_1erTeste_acidejdphfiZV.png" width="1000px"><br> | ||
+ | <p class="legend"><b>Figure 24 :</b>Table manipulation</p><br> | ||
+ | |||
+ | We don’t have enough reagents in our kit to do all manipulations we want, and it is too late to buy it. We choose to delete three concentrations by strain and in the scale. <br> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2015/d/de/PariBettencourt_1erTeste_acide_phytiquerggrrrgrgert-jhtTH.png" width="1000px"><br> | ||
+ | <p class="legend"><b>Figure 25 :</b>New table manipulation</p><br> | ||
+ | |||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2015/b/bb/PariBettencourt_hghdhfuhgggkhgchggv.png" width="1000px"><br> | ||
+ | <p class="legend"><b>Figure 26 :</b>Result of test</p><br> | ||
+ | |||
+ | Result analysis: We have only optic density result below zero. Normally is no possible. We suppose the reagents of the kit are old and it not work. Would have had to do again the tests but there is not reagents and time anymore. <br> | ||
+ | |||
Latest revision as of 14:04, 30 October 2015