Difference between revisions of "Team:Paris Bettencourt/Notebook/Phytase"

 
(39 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
{{Paris_Bettencourt/header}}
 
{{Paris_Bettencourt/header}}
 
{{Paris_Bettencourt/menu}}
 
{{Paris_Bettencourt/menu}}
−
{{Paris_Bettencourt/notebookBanner}}
+
{{Paris_Bettencourt/banner|page_id=notebook|page_name=Notebook - Phytase}}
 
<html>
 
<html>
  
Line 325: Line 325:
 
<h2>Result of colony PCR (August 19th)</h2>
 
<h2>Result of colony PCR (August 19th)</h2>
 
<div class="column-left"><br><br><p>
 
<div class="column-left"><br><br><p>
−
We only see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony.
+
We see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony. There is DNA in holes too, which didn't migrate, probably the genomic DNA.
 
</p></div>
 
</p></div>
  
Line 369: Line 369:
 
<div class="column-right"><p>
 
<div class="column-right"><p>
 
The DNA ladder migrate, but there was any amplification of the both genes.<br>
 
The DNA ladder migrate, but there was any amplification of the both genes.<br>
−
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of OH plasmid and the oligos using for PHO85 gene.
+
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of HO plasmid and the oligos using for PHO85 gene.
 
</p></div>
 
</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
Line 400: Line 400:
 
<h2>Phytic acid dosage</h2>  
 
<h2>Phytic acid dosage</h2>  
 
<div class="column-right"><p>
 
<div class="column-right"><p>
−
We dose the phytic acid in fermented rice.</p></div>
+
We dose the phytic acid in fermented rice.<br>
 +
After analysis, the fermented rice have very little quantity of phosphorus and of phytic acid.<br>
 +
<b>[Phosphorus] :</b> 0.0758 mg/100g of rice.<br>
 +
<b>[Phytic acid] :</b> 0.269 mg/100g of rice.</p></div>
 
<div class="column-left">
 
<div class="column-left">
−
<img src="https://static.igem.org/mediawiki/2015/6/6b/PariBettencourt_1erTeste_acide_phytique.png" width="550px">
+
<img src="https://static.igem.org/mediawiki/2015/0/09/ParisBettencourtPhyticAcidTitration1.png" width="550px">
−
<p class="legend"><b>Figure 12 :</b> Acid phytic dosage on fermented rice</p></div>
+
<p class="legend"><b>Figure 11 :</b> Phosphorus calibration curve for titration of phytic acid in fermented rice</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
  
Line 409: Line 412:
 
<div class="column-right">
 
<div class="column-right">
 
<img src="https://static.igem.org/mediawiki/2015/f/fe/ParisBettencourt_PCR_colony_gradient_27.08.15_%282%29.png" width="550px">
 
<img src="https://static.igem.org/mediawiki/2015/f/fe/ParisBettencourt_PCR_colony_gradient_27.08.15_%282%29.png" width="550px">
−
<p class="legend"><b>Figure 11 :</b> Second electrophoresis colony PCR with temperature gradient (non-transformed yeast)</p></div>
+
<p class="legend"><b>Figure 12 :</b> Second electrophoresis colony PCR with temperature gradient (non-transformed yeast)</p></div>
 
<div class="column-left">
 
<div class="column-left">
 
<p>We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.<br>We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.</p></div>
 
<p>We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.<br>We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.</p></div>
Line 419: Line 422:
 
<br><h1 class="date one">August 28th</h1>
 
<br><h1 class="date one">August 28th</h1>
 
<h2>Phytic acid dosage in different strains</h2>  
 
<h2>Phytic acid dosage in different strains</h2>  
−
<div class="column-left">
+
 
−
<img src="https://static.igem.org/mediawiki/2015/6/6e/ParisBettencourt_Dosage_acide_phytique_2.png" width="750px">
+
<img src="https://static.igem.org/mediawiki/2015/3/3c/ParisBettencourtTitrationPhyticAcidCurve2.png" width="750px"><br><br>
−
<p class="legend"><b>Figure 13 :</b> Acid phytic dosage on fermented rice with some strains</p><br>
+
<img src="https://static.igem.org/mediawiki/2015/b/bb/ParisBettencourtTitrationPhyticAcidResultsOD2.png" width="1000px">
−
<img src="https://static.igem.org/mediawiki/2015/b/b2/ParisBettencourtTableau_r%C3%A9sultatsacidphytic.png" width="325px">
+
<p class="legend"><b>Figure 13 :</b> Phosphorus calibration curve + results of OD in some strains</p><br>
−
<p class="legend"><b>Figure 14 :</b> Results of acid phytic dosage on fermented rice</p></div>
+
<img src="https://static.igem.org/mediawiki/2015/8/85/ParisBettencourtTitrationPhyticAcidResultsConcentration2.png" width="850px">
−
<div style="clear:both"></div>
+
<p class="legend"><b>Figure 14 :</b> Results of acid phytic dosage on fermented rice</p>
  
 
<h2>Results of PCR</h2>  
 
<h2>Results of PCR</h2>  
Line 432: Line 435:
 
</div>
 
</div>
 
<div class="column-right"><p>We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.<br>
 
<div class="column-right"><p>We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.<br>
−
The controle postive with the OH plasmid worked, the band matches with the PHO85 gene size (1020bp).
+
The controle postive with the HO plasmid worked, the band matches with the PHO85 gene size (1020bp).
 
</p></div>
 
</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
Line 438: Line 441:
 
<br>
 
<br>
 
<div class="column-left">
 
<div class="column-left">
−
<img src="https://static.igem.org/mediawiki/2015/3/37/ParisBettencourt_Gel_28.08_Gradient_yeast_transfo_2temp_80-85-FRT.png" width="550px">
+
<img src="https://static.igem.org/mediawiki/2015/3/37/ParisBettencourt_Gel_28.08_Gradient_yeast_transfo_2temp_80-85-FRT.png" width="300px">
 
<p class="legend"><b>Figure 16 :</b> Electrophoresis PCR transformed yeasts</p><br>
 
<p class="legend"><b>Figure 16 :</b> Electrophoresis PCR transformed yeasts</p><br>
 
</div>
 
</div>
−
<div class="column-right"><p>the positive control is negative PCR does not therefore our work.
+
<div class="column-right"><p>The positive control is negative, PCR does not therefore our work.
 
</p></div>
 
</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
−
<h2> Transformation</h2>
+
<h2>Transformation</h2>
−
We transform the yeast (...) with the resistance to geneticin and the CRE gene. We delete the PHO 85 genes and we replace it by the resistance gene.<br>
+
We transform the yeast <i>Saccharomyces cerevisiae SK1</i> with the resistance to geneticin and the <i>Cre</i> gene. We delete the PHO 85 genes and we replace it by the resistance gene.<br>
 
<div class="column-right">
 
<div class="column-right">
 
<img src="https://static.igem.org/mediawiki/2015/e/e7/PARISBETTENCOURT_CRE.png" width="550px">
 
<img src="https://static.igem.org/mediawiki/2015/e/e7/PARISBETTENCOURT_CRE.png" width="550px">
−
<p class="legend"><b>Figure 16 :</b>Principle of Cre recombinase</p><br>
+
<p class="legend"><b>Figure 17 :</b>Principle of Cre recombinase</p><br>
 
</div>
 
</div>
−
<div class="column-left"><p><br>The CRE gene is the sequence that little be cut thanks Cre recombinase and reconbined the gene without the sequence between the CRE gene.</p></div>
+
<div class="column-left"><p><br>The <i>Cre</i> gene is the sequence that little be cut thanks Cre recombinase and recombined the gene without the sequence between the Cre sequences.</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
 
<br>
 
<br>
−
<b>Protocol :</b> <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> transformation of yeast</a>
+
 
 +
 
 +
 
  
 
<br><h1 class="date one">August 30th</h1>
 
<br><h1 class="date one">August 30th</h1>
−
<h2>The transformation on yeasts with <i>Cre</i> gene</h2>
+
<h2>Transformation on yeasts with <i>Cre</i> gene</h2>
 +
First step, we realize the PCR of <i>Cre</i> and <i>RFP</i> gene with primers (created by Amaury) and plasmid containing RFP. We amplified the gene, its promoter and its terminater.<br>
 +
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR"> PCR</a><br>
 +
<br>
 +
 
 +
Second step, we make PCR purification, and check the result with electrophoresis.<br>
 +
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification</a>
 +
<br>
 +
<br>
 +
Third step, we transformed yeast that is already integrated the resistance instead of PHO85 gene. We introduce the <i>Cre</i> and <i>RFP</i> genes instead of PHO80 gene<br>
 +
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> Transformation of yeast</a><br>
 +
<br>
 +
Fourth step, we cultived the transforming yeasts in YPD agar medium with geneticin overnight.
 +
<br><br>
 +
</p>
 +
 
 +
<h2>PCR and result</h2>
 +
<div class="column-left"></p>We did electrophoresis of transformation product. It's revealed bands around 10,000bp, while we expected 1,000bp. We think the DNA extraction in yeast doesn't work, and these bands are contamination.</div>
 +
<div class="column-right">
 +
<img src="https://static.igem.org/mediawiki/2015/b/bf/ParisBettencourt_PCRgelRFPCRE.png" width="400px">
 +
<p class="legend"><b>Figure 18 :</b> Colony PCR on transformed yeast with RFP</p></div>
 +
<div style="clear:both"></div>
 +
 
 +
 
  
−
We watching Any culture on plates YPD + Geneticin. The yeast are not resistant to geneticin, the yeasts has not introduced the resistance gene. Transformation does not work.</p>
 
  
 
<a name="september" class="anchor"><h1></h1></a>
 
<a name="september" class="anchor"><h1></h1></a>
 +
<br><h1 class="date two">September 1st</h1>
 +
<h2>Result of transformation</h2>
 +
We watching any culture on plates YPD + Geneticin. The yeast are not resistant to geneticin, they had not introduced the resistance gene. Transformation does not work.
 +
 +
 
<br><h1 class="date two">September 2nd</h1>
 
<br><h1 class="date two">September 2nd</h1>
 
<h2> Transformation</h2>
 
<h2> Transformation</h2>
Line 467: Line 499:
 
<h2>Titration of phytic acid</h2>
 
<h2>Titration of phytic acid</h2>
 
We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.<br>
 
We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.<br>
−
Strains : 915,37 / 915,55 / 915,56 / 915,57 / 915,58 / Sook dall + HCl / Sook rice + HCl
+
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl.
  
  
Line 473: Line 505:
 
<br><h1 class="date two">September 4th</h1>
 
<br><h1 class="date two">September 4th</h1>
  
−
After the transformation of September 2nd, any culture is observable on plates. The tansformation are not function. We restart transformation, but we transform with Cre and RFP gene. It is more interesting because we not forced to simply remove the resistance gene, we can make a double identification. It helps to identify yeast that is already integrated in place of the resistance gene PHO85 (they cultivate on agar with geneticin) and we also integrate the RFP gene in place of PHO80 gene (they will be red).
+
After the transformation of September 2nd, any culture is observable on plates. The tansformation are not function. We restart transformation, but we transform with <i>Cre</i> and <i>RFP</i> genes. It is more interesting because we not forced to simply remove the resistance gene, we can make a double identification. It helps to identify yeast that is already integrated in place of the resistance gene PHO85 (they cultivate on agar with geneticin) and we also integrate the RFP in place of PHO80 gene (they will be red).
  
  
Line 481: Line 513:
 
<br><h1 class="date two">September 8th</h1>
 
<br><h1 class="date two">September 8th</h1>
  
−
<h2>Transformation with the CRE and RFP gene</h2>
+
<h2>PCR to product cassette Cre/RFP</h2>
  
−
We restart the transformation of September 2nd, with Cre sequence and RFP gene.<br>
+
We restart PCR with Cre sequence and RFP gene.<br>
  
−
First step, we realize the PCR of CRE and RFP gene with primers (created by Amaury) and plasmid containing RFP. We amplified the gene, its promoter and its terminater.<br>
 
−
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR"> PCR</a><br>
 
−
<br>
 
  
−
Second step, we make PCR purification, and check the result with electrophorese<br>
 
−
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/PCR_purification"> PCR purification</a>
 
−
<br>
 
  
 
<div class="column-left">
 
<div class="column-left">
 
<br><img src="https://static.igem.org/mediawiki/2015/f/f3/ParisBettencourt_PCRelectrophoresisCRERFP.jpeg" width="450px">
 
<br><img src="https://static.igem.org/mediawiki/2015/f/f3/ParisBettencourt_PCRelectrophoresisCRERFP.jpeg" width="450px">
−
<p class="legend"><b>Figure 17 : </b>Electrophoresis of Cre and RFP amplification</p><br>
+
<p class="legend"><b>Figure 19 : </b>Electrophoresis of Cre and RFP amplification</p><br>
 
</div>
 
</div>
 
<div class="column-right"><p><br>We see only one band. We can continue experiments with this sample and realize the transformation.</p></div>
 
<div class="column-right"><p><br>We see only one band. We can continue experiments with this sample and realize the transformation.</p></div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
  
−
Third step, we transformed yeast that is already integrated the resistance instead of PHO85 gene. We introduce the CRE and RFP gene instead of PHO80 gene<br>
 
−
<b>Protocol</b> :<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/Heat_shock_transformation_for_yeast"> Transformation of yeast</a><br>
 
−
 
−
Fourth step, we cultived the transforming yeasts in YPD agar medium with geneticin overnight.
 
  
 
<h2> Analysis of results of titration phytic acid of September 2nd</h2>   
 
<h2> Analysis of results of titration phytic acid of September 2nd</h2>   
−
We Tests the acid phytique concentration in the 915,37 dilution 1/5, 915,37 dilution 1/50, 915,37 dilution 1/500, 915,55 dilution 1/5, 915,55 dilution 1/50, 915,55 dilution 1/500, 915,56 dilution 1/5, 915,56 dilution 1/50, 915,56 dilution 1/500, 915,57 dilution 1/50, 915,57 dilution 1/500, 915,58 dilution 1/5, 915,58 dilution 1/50, 915,58 dilution 1/500, sook dall + HCl and sook rice + HCl<br>
+
We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.<br>
 +
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl.
  
−
We start to do the gamme.<br><br>
+
We start to do the phosphorus scale.<br><br>
−
<div class="column-left">
+
 
−
<img src="https://static.igem.org/mediawiki/2015/3/36/Paris_bettencoursGamme.png" width="200px">
+
<img src="https://static.igem.org/mediawiki/2015/c/cb/ParisBettencourtTitrationPhyticAcidCurve3.png" width="500px">
−
<p class="legend"><b>Figure 18 :</b> Initial results of gamme</p></div>
+
<p class="legend"><b>Figure 20 :</b> Phosphorus calibration curve</p>
−
<div class="column-right">
+
−
<img src="https://static.igem.org/mediawiki/2015/1/18/Paris_bettencourtCourbe_Gamme.png" width="500px">
+
−
<p class="legend"><b>Figure 19 :</b> Curve of gamme</p></div>
+
−
<div style="clear:both"></div>
+
 
<br>
 
<br>
−
With calculations which are in the protocol, we have the concentration in our samples.<br>
+
With calculations of the protocol, we can determine the concentration in our samples.<br>
  
−
<b>Protocol :</b><a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols/titration-acid-phytic"> Titration of phytic acid</a>
+
<b>Protocol :</b><a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#FSTitrationacidphytic"> Titration of phytic acid</a>
 
<br><br>
 
<br><br>
 
    
 
    
−
<img src="https://static.igem.org/mediawiki/2015/6/69/Paris_bettencoursTableau_phytique_acid.png" width="600px">
+
<img src="https://static.igem.org/mediawiki/2015/8/8f/ParisBettencourt_TAB85jdkshdjs6255666666.png" width="600px">
−
<p class="legend"><b>Figure 20 :</b> Table of results</p>
+
<p class="legend"><b>Figure 21 :</b> Table of results</p>
 +
Concentrations are very low. There are less to 1mg/100g d’idli.
 +
 
 +
 
 +
 
 +
 
 +
<br><h1 class="date two">September 11th</h1>
 +
<h2>Transformation</h2>
 +
We did the transformation on strain <i>Saccharomyces cerevisiae SK1</i>, using the protocol of<a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#HeatShockYeast"> heat shock yeast transformation</a>.
 +
 
  
  
Line 530: Line 558:
 
<br><h1 class="date two">September 14th</h1>
 
<br><h1 class="date two">September 14th</h1>
 
<h2>Genomic DNA extraction of transformed yeast</h2>
 
<h2>Genomic DNA extraction of transformed yeast</h2>
−
We try to extract genomic DNA of transformed yeast with the "Blood and Tissue extract" kit.
+
We try to extract genomic DNA of transformed yeast with the <a href="https://2015.igem.org/Team:Paris_Bettencourt/Protocols#YeastDNAextractiondneasybloodandtissuekit"> "Blood & Tissue extraction Kit"</a>
 
<br>
 
<br>
−
We make colony PCR on it.
+
We make PCR on it.
  
 
<h2>Result of PCR</h2>
 
<h2>Result of PCR</h2>
−
<div class="column-left"></p>The electrophoresis revealed bands around 10,000bp, while we expected 1,000bp. We think the DNA extraction in yeast doesn't work, and these bands are contamination.</div>
+
The gel electrophoresis revealed any bands. We might suppose that the transformation did not work, but it's probably that we don't succeed to extract the yeast's DNA which prevent us to verify our results.
−
<div class="column-right">
+
 
−
<img src="https://static.igem.org/mediawiki/2015/b/bf/ParisBettencourt_PCRgelRFPCRE.png" width="400px">
+
 
−
<p class="legend"><b>Figure 19 :</b> Colony PCR on transformed yeast with RFP</p></div>
+
 
 +
 
 +
 
 +
<br><h1 class="date two">September 15th</h1>
 +
<h2>Plate of yeast transformed with RFP</h2>
 +
<div class="column-left">
 +
<img src="https://static.igem.org/mediawiki/2015/6/60/ParsBettencourt_PlateAMAURYRFPCRE.jpeg" width="300px">
 +
<p class="legend"><b>Figure 22 :</b> Transformed <i>S. cerevisiae SK1</i> on YPD agar + geneticin</p></div>
 +
<div class="column-right">Colonies are not isolated, we cannot distinguish all of them. The culture that was inoculate was too concentrate.
 +
We make suspensions low concentrate and inoculate again on YPD medium with geneticin at 200µg/mL.
 +
</div>
 
<div style="clear:both"></div>
 
<div style="clear:both"></div>
 +
 +
 +
 +
 +
<br><h1 class="date two">September 16th</h1>
 +
<h2>Plate of yeast transformed with RFP</h2>
 +
<div class="column-left">
 +
<img src="https://static.igem.org/mediawiki/2015/9/97/ParisBettencourt_PCRgelRFPCRE1.jpeg" width="300px">
 +
<p class="legend"><b>Figure 23 :</b> Transformed <i>S. cerevisiae SK1</i> on YPD agar + geneticin</p></div>
 +
<div class="column-right">All colonies are the same, but there is no red coloration.<br>
 +
These result can be explicated by the fact that when this gene is introduced in the genomic DNA, it's not revealed, whereas it is in a plasmid.
 +
</div>
 +
<div style="clear:both"></div>
 +
 +
<h2>Test new transformed yeast</h2>
 +
We test our new transformed yeast which deletion of PHO80 and PHO85 genes and compare with yeast transformed previously (first with the geneticin resistance gene in place PHO85 gene and second with the  geneticin resistance gene in place PHO80). We put this yeast in YPD + geneticin medium (YPD + geneticinn for always keep the selection). We have grown the yeast with six concentration of phytic acid (0.005, 0.01, 0.02, 0.04, 0.1, 0.2 g/mL). We also realize a scale with phytic acid and YPD medium + geneticin. <br>
 +
Scale: C(phytic acid;YPD) (g.mL-1) 0,005 0,01 0,02 0,04 0,1 <br>
 +
 +
<img src="https://static.igem.org/mediawiki/2015/1/15/PariBettencourt_1erTeste_acidejdphfiZV.png" width="1000px"><br>
 +
<p class="legend"><b>Figure 24 :</b>Table manipulation</p><br>
 +
 +
We don’t have enough reagents in our kit to do all manipulations we want, and it is too late to buy it. We choose to delete three concentrations by strain and in the scale. <br>
 +
 +
<img src="https://static.igem.org/mediawiki/2015/d/de/PariBettencourt_1erTeste_acide_phytiquerggrrrgrgert-jhtTH.png" width="1000px"><br>
 +
<p class="legend"><b>Figure 25 :</b>New table manipulation</p><br>
 +
 +
 +
<img src="https://static.igem.org/mediawiki/2015/b/bb/PariBettencourt_hghdhfuhgggkhgchggv.png" width="1000px"><br>
 +
<p class="legend"><b>Figure 26 :</b>Result of test</p><br>
 +
 +
Result analysis: We have only optic density result below zero. Normally is no possible. We suppose the reagents of the kit are old and it not work. Would have had to do again the tests but there is not reagents and time anymore. <br>
  
  

Latest revision as of 14:04, 30 October 2015

August 10th

Design primers

Gene PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA TCCATACATTTTGATGGC -3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG CGACCAGCATTC-5’

- Homology tail on gene PHO85
- Kanamycin resistance binding

Gene PHO80

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT ACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA GCATTC-5’

- Homology tail on gene PHO80
- Kanamycin resistance binding

Gene FRT + PHO85

5’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’

3’Primer of Kanamycin resistance gene with tails using to transformation with the PHO85 gene of the yeast, including FRT sequence to delete both of PHO80 and PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- FRT sequence
- Kanamycin resistance binding

August 12nd

Culture

Inoculate 100µL of Saccharomyces cerevisiae SK1 on YPD medium overnight (at 30°C).
This yeast will be transformed.

PCR

3 PCR were realized on HO-Poly-KanMX4-HO plasmid to create a Kanamycin resistance marker, thanks to 3 pairs of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.


Protocol:
PHO80 PHO85 FRT+ PHO85
Master mix (µL) 50 50 50
H2O DNAse Free (µL) 45 45 45
Resistance plasmid (µL) 1 1 1
PHO80 5'Primer (µL) 2
PHO80 3'Primer (µL) 2
PHO85 5'Primer (µL) 2
PHO85 3'Primer (µL) 2
PHO85 + FRT 5'Primer (µL) 2
PHO85 + FRT 3'Primer (µL) 2

Figure 1 : PCR cycle


August 13th

PCR Purification

Protocol : PCR purification

Result of PCR (August 12th)


The PCR product are then revealed with a gel electrophoresis.
We expected bands around 1.300bp. The band corresponding to marker with FRT is bigger than the two others strips because these have just the Kanamycin resistance with tails, and no FRT sequences.



Figure 2 :Result of PCR


Pre-culture

Plated one colony of Saccharomyces cerevisiae SK1 in 5mL liquid YPD medium and let's grow overnight.

August 14th

Transformation of yeast

Protocol: Heat shock transformation for yeast

August 17th

Result of plates:

There is a culture in plates.

The negative control is not well. The no change yeast grow in the YPD medium with the antibiotic.
We will repeat this control on an agar plate and not in a liquid medium.

We analyze anyway down results, the results of the new control will allow us to validate the result of our experiment or search which are our error and try again.





The positive control is well, yeast multiply on YPD medium plate without antibiotic. Yeasts are not dead, so the culture on other agar mediums are not contamination.

We see more colonies on the plates with yeast transforming PHO85 and FRT+PHO85.

We look only few colonies in the plates with yeast transforming PHO80.

The result is well, transformation works.


Figure 3 : Negative control

Figure 4 : Positive control and result of transformation

Design primers

We design primers to verifie our results on the plates.
Thanks to the colony PCR, we might determinate if the resistance is integrated into the yeast DNA.
Primer 5'-3' PHO80
ATCATAAGACGAGGATATCCTTTGGAG

Primer 3'-5' PHO80
CTCAATCATGATTGCTTTCATAATACCCC

Primer 5'-3' PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' PHO85
AAGGGATATATAGCGCGGCAAACTG

Primer 5'-3' FRT+PHO85
TATCATTATATATACATGGCTACGGTTTTTCG

Primer 3'-5' FRT+PHO85
AAGGGATATATAGCGCGGCAAACTG


August 18th

Verification of the new negative control

The verification of the negative control is good, any colony is watching. We can continue our experiments, it will be validated.


Figure 5 : Result of the new negative control

FRT problems

The transformation with the FRT may be run well, but the plasmid with the gene coding for flippase works only for E. coli. We can't use this plasmid because it will be rejected by the yeast.
Other transformation with CreLox system is possible.
CreLox is a gene which have the same fonction than the FRT, it not cut by the flippase but by the Cre recombinase.



We design two primers for the new transformation with CreLox system.

Primer 5'-3' CreLox + PHO85

5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAACTTCGTATAGCATACATTATACGAAGTTATATAATCATTTGCATCCATACATTTTGATGGC-3’

Primer 3'-5' CreLox + PHO85

3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCAATAACTTCGTATAGCATACATTATACGAAGTTATCAGCAGTATAGCGACCAGCATTC-5’

- Homology tail on gene PHO85
- CreLox sequence
- Kanamycin resistance binding

August 19th

Colony PCR

Protocol:
PHO80 PHO85 FRT+ PHO85
dreamTaq 2X (µL) 3 3 3
H2O DNAse Free (µL) 9 9 9
Colony 1 1 1
PHO80 5'Primer (µL) 0.5
PHO80 3'Primer (µL) 0.5
PHO85 5'Primer (µL) 0.5 0.5
PHO85 3'Primer (µL) 0.5 0.5

Figure 6 : Colony PCR cycle


August 20th

Result of colony PCR (August 19th)



We see bands smaller than 500bp, but not the fragments we expected : this is probably contaminations. We start again the same PCR colony. There is DNA in holes too, which didn't migrate, probably the genomic DNA.

Figure 7 : Electrophoresis PCR colony


Colony PCR

Same to August 19th.

Result of second colony PCR

Figure 8 : second electrophoresis colony PCR

The DNA Ladder is good but DNA of PCR did not migrate. The ADN is in the holes. We think that the yeasts walls being thicker simple thermic shock does not break it. We will be carry a lysis whith NaOH in yeast, to push out DNA, to the primer can be fixed on it.


August 24th

Yeast lysis with NaOH

Protocol: Yeast lysis with NaOH
After the lysis of yeast we realize the new PCR in normal condition, the same as August 12nd.

August 25th

Result of PCR (August 24th)

Figure 9 : Third electrophoresis colony PCR with NaOH lysis

The DNA ladder migrate, but there was any amplification of the both genes.
We tested two PCR mix : the first did not work. The positive control worked with the second PCR mix. It is composed of HO plasmid and the oligos using for PHO85 gene.


August 26th

Colony PCR

To make the colony PCR, we need to lysis yeasts' wall. We realized the lysis with NaOH, but it did not work. So we realize a new lysis using the " DNeasy Blood and Tissue Kit" with the zymolyase enzyme on the non-transformed yeasts to verifie the melting temperature of primers (try between 55°C and 65°C) and if the amplification of the genes work.


Phytic acid dosage

We dose the phytic acid in the fermented rice with the kit " Phytic Acid (Total Phosphorus) Assay Kit ".

August 27th

Result of PCR (August 26th)

Figure 10 : Electrophoresis colony PCR with temperature gradient on non-transformed yeasts lysed by the zymolyase

We made a PCR gradient on non-transformed yeast to know exactly wich temperature is better to a good fixation of the primers on the DNA.
The amplification failed, we supposed it is because our MasterMix did not work. We will try this PCR again.

Phytic acid dosage

We dose the phytic acid in fermented rice.
After analysis, the fermented rice have very little quantity of phosphorus and of phytic acid.
[Phosphorus] : 0.0758 mg/100g of rice.
[Phytic acid] : 0.269 mg/100g of rice.

Figure 11 : Phosphorus calibration curve for titration of phytic acid in fermented rice

Result of second PCR

Figure 12 : Second electrophoresis colony PCR with temperature gradient (non-transformed yeast)

We watch bands for the gene PHO80, at the good size : 882bp. But the gene PHO85, there was no amplifiction, and the positive control is negative : we only see aband bigger than 10,000bp and it is not what we expected.
We try again this PCR to see if the no amplification of the gene PHO85 it is a manipulation error or not.


August 28th

Phytic acid dosage in different strains



Figure 13 : Phosphorus calibration curve + results of OD in some strains


Figure 14 : Results of acid phytic dosage on fermented rice

Results of PCR

Figure 15 : Third electrophoresis gradient PCR (non-transformed yeast)


We watch bands for the both of genes, but not at the same temperatures. Thanks to the gradient, we can suppose that oligos have not exactly the same melting temperature, and it may be the reason why the previous PCR failed.
The controle postive with the HO plasmid worked, the band matches with the PHO85 gene size (1020bp).


Figure 16 : Electrophoresis PCR transformed yeasts


The positive control is negative, PCR does not therefore our work.

Transformation

We transform the yeast Saccharomyces cerevisiae SK1 with the resistance to geneticin and the Cre gene. We delete the PHO 85 genes and we replace it by the resistance gene.

Figure 17 :Principle of Cre recombinase



The Cre gene is the sequence that little be cut thanks Cre recombinase and recombined the gene without the sequence between the Cre sequences.



August 30th

Transformation on yeasts with Cre gene

First step, we realize the PCR of Cre and RFP gene with primers (created by Amaury) and plasmid containing RFP. We amplified the gene, its promoter and its terminater.
Protocol : PCR

Second step, we make PCR purification, and check the result with electrophoresis.
Protocol : PCR purification

Third step, we transformed yeast that is already integrated the resistance instead of PHO85 gene. We introduce the Cre and RFP genes instead of PHO80 gene
Protocol : Transformation of yeast

Fourth step, we cultived the transforming yeasts in YPD agar medium with geneticin overnight.

PCR and result

We did electrophoresis of transformation product. It's revealed bands around 10,000bp, while we expected 1,000bp. We think the DNA extraction in yeast doesn't work, and these bands are contamination.

Figure 18 : Colony PCR on transformed yeast with RFP

September 1st

Result of transformation

We watching any culture on plates YPD + Geneticin. The yeast are not resistant to geneticin, they had not introduced the resistance gene. Transformation does not work.

September 2nd

Transformation

We start again the transformation of august 28th, with the same protocol.

Titration of phytic acid

We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl.

September 4th

After the transformation of September 2nd, any culture is observable on plates. The tansformation are not function. We restart transformation, but we transform with Cre and RFP genes. It is more interesting because we not forced to simply remove the resistance gene, we can make a double identification. It helps to identify yeast that is already integrated in place of the resistance gene PHO85 (they cultivate on agar with geneticin) and we also integrate the RFP in place of PHO80 gene (they will be red).

September 8th

PCR to product cassette Cre/RFP

We restart PCR with Cre sequence and RFP gene.

Figure 19 : Electrophoresis of Cre and RFP amplification



We see only one band. We can continue experiments with this sample and realize the transformation.

Analysis of results of titration phytic acid of September 2nd

We test the quantity of phytic acid different strains, at dilution 1/5, 1/50 and 1/500.
Strains : g15,37 / g15,55 / g15,56 / g15,57 / g15,58 / Sook dall + HCl / Sook rice + HCl. We start to do the phosphorus scale.

Figure 20 : Phosphorus calibration curve


With calculations of the protocol, we can determine the concentration in our samples.
Protocol : Titration of phytic acid

Figure 21 : Table of results

Concentrations are very low. There are less to 1mg/100g d’idli.

September 11th

Transformation

We did the transformation on strain Saccharomyces cerevisiae SK1, using the protocol of heat shock yeast transformation.

September 14th

Genomic DNA extraction of transformed yeast

We try to extract genomic DNA of transformed yeast with the "Blood & Tissue extraction Kit"
We make PCR on it.

Result of PCR

The gel electrophoresis revealed any bands. We might suppose that the transformation did not work, but it's probably that we don't succeed to extract the yeast's DNA which prevent us to verify our results.

September 15th

Plate of yeast transformed with RFP

Figure 22 : Transformed S. cerevisiae SK1 on YPD agar + geneticin

Colonies are not isolated, we cannot distinguish all of them. The culture that was inoculate was too concentrate. We make suspensions low concentrate and inoculate again on YPD medium with geneticin at 200µg/mL.

September 16th

Plate of yeast transformed with RFP

Figure 23 : Transformed S. cerevisiae SK1 on YPD agar + geneticin

All colonies are the same, but there is no red coloration.
These result can be explicated by the fact that when this gene is introduced in the genomic DNA, it's not revealed, whereas it is in a plasmid.

Test new transformed yeast

We test our new transformed yeast which deletion of PHO80 and PHO85 genes and compare with yeast transformed previously (first with the geneticin resistance gene in place PHO85 gene and second with the geneticin resistance gene in place PHO80). We put this yeast in YPD + geneticin medium (YPD + geneticinn for always keep the selection). We have grown the yeast with six concentration of phytic acid (0.005, 0.01, 0.02, 0.04, 0.1, 0.2 g/mL). We also realize a scale with phytic acid and YPD medium + geneticin.
Scale: C(phytic acid;YPD) (g.mL-1) 0,005 0,01 0,02 0,04 0,1

Figure 24 :Table manipulation


We don’t have enough reagents in our kit to do all manipulations we want, and it is too late to buy it. We choose to delete three concentrations by strain and in the scale.

Figure 25 :New table manipulation



Figure 26 :Result of test


Result analysis: We have only optic density result below zero. Normally is no possible. We suppose the reagents of the kit are old and it not work. Would have had to do again the tests but there is not reagents and time anymore.